ID: 1118866112

View in Genome Browser
Species Human (GRCh38)
Location 14:69704905-69704927
Sequence ATGCAAAGCAATAAGCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118866112_1118866115 15 Left 1118866112 14:69704905-69704927 CCATTGTGCTTATTGCTTTGCAT 0: 1
1: 0
2: 6
3: 43
4: 395
Right 1118866115 14:69704943-69704965 TCATAGGAACATTGCAGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 187
1118866112_1118866116 24 Left 1118866112 14:69704905-69704927 CCATTGTGCTTATTGCTTTGCAT 0: 1
1: 0
2: 6
3: 43
4: 395
Right 1118866116 14:69704952-69704974 CATTGCAGATGAGGAAATTGAGG 0: 2
1: 19
2: 176
3: 1322
4: 5963
1118866112_1118866113 -1 Left 1118866112 14:69704905-69704927 CCATTGTGCTTATTGCTTTGCAT 0: 1
1: 0
2: 6
3: 43
4: 395
Right 1118866113 14:69704927-69704949 TACATTATCTTAATCCTCATAGG 0: 1
1: 0
2: 3
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118866112 Original CRISPR ATGCAAAGCAATAAGCACAA TGG (reversed) Intronic
900161423 1:1225812-1225834 AGGCAGAGCAAAAAGCAAAAAGG + Intronic
901135659 1:6992392-6992414 ATGGAAAGAAATAATCAGAAAGG - Intronic
902738791 1:18419760-18419782 ATGCAAGGTAATCAGCACGAGGG - Intergenic
903155890 1:21442559-21442581 ATGAAAAGCAGTAACCATAAAGG - Intronic
904225857 1:29018667-29018689 ATGTAAAGCACTTAGCACAGTGG + Intronic
905328943 1:37178656-37178678 AAGAAAAGCATTTAGCACAATGG - Intergenic
907931252 1:59002935-59002957 AAGGAAATCAATAAGCAAAAAGG - Intergenic
908060976 1:60348552-60348574 ATGCAAAGCACTCAGCACAGAGG + Intergenic
908843535 1:68301909-68301931 TTGCAAAGCACAAAACACAAAGG + Intergenic
909032999 1:70563757-70563779 ATTCTAAGCAAAAAGAACAAAGG - Intergenic
909369093 1:74862922-74862944 ATCCTAAGCAAAAAGGACAAAGG - Intergenic
910043896 1:82888473-82888495 AGGCAAAGCATGAAGGACAAAGG - Intergenic
910292693 1:85614797-85614819 ATGCAAGCCAAAATGCACAAAGG + Intergenic
910618469 1:89226644-89226666 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
911492130 1:98583188-98583210 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
911667974 1:100575661-100575683 ACACAAAGCAATAAGAACAGAGG + Intergenic
911757266 1:101573106-101573128 ATCCAAAGCGATAAGAAAAAAGG + Intergenic
912735527 1:112146595-112146617 ATGGAAAGTGACAAGCACAAAGG + Intergenic
913362552 1:117998498-117998520 ATCCTAAGCAAAAAGAACAAAGG - Intronic
916251279 1:162740803-162740825 TTGGAAAGCAATAAGCAAATGGG + Intronic
917164173 1:172093093-172093115 ATGCAGAGCAAGTAGCAGAAAGG - Intronic
917356001 1:174126908-174126930 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
917430739 1:174965761-174965783 CTGCAAAGCAAGCAGCACAGTGG - Intronic
917482715 1:175425899-175425921 ATGCAAGGCCATAGGCACCATGG - Intronic
917508930 1:175654170-175654192 ATGAAAGGCAATAAGCAAGAAGG - Intronic
918100791 1:181372040-181372062 ATCCCAAGCAAAAAGAACAAAGG - Intergenic
918773535 1:188596750-188596772 ATGCAAAGCAAAAAGCAAAAAGG + Intergenic
920142467 1:203827838-203827860 ATATAAAGCACTAAGCACATAGG - Intronic
921030848 1:211334069-211334091 ATACAAAGCAAAATGAACAAAGG + Intronic
921626426 1:217382011-217382033 ATGCAAAGCAAAAAACAGCAGGG + Intergenic
922716435 1:227876511-227876533 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
923442978 1:234039208-234039230 ATGCACAGCAAAACCCACAAGGG + Intronic
924329000 1:242923715-242923737 AAGCAACGCATTAAACACAAGGG - Intergenic
924817498 1:247455520-247455542 ATGCAAACAAATAAGGAGAAAGG - Intergenic
1063240011 10:4159255-4159277 ATGTTAAGCAATAAGAATAATGG + Intergenic
1063684638 10:8225091-8225113 ATGGAGAGCAATTAGCAAAAAGG + Intergenic
1064604658 10:17026330-17026352 TTGCAAAGCAAGAATCACAGAGG + Intronic
1065708517 10:28493412-28493434 ATGCTAAGCAGTAATGACAATGG + Intergenic
1066087711 10:31987209-31987231 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1066147794 10:32579635-32579657 ATGCAAAGCAAAATGAGCAAAGG + Intronic
1066402756 10:35091208-35091230 ATGAAAGGCAAAAAGCACTAAGG - Intergenic
1067124438 10:43504193-43504215 ATACAAAACAAAAACCACAATGG - Intergenic
1067516781 10:46954760-46954782 ATCCAAAGCAAGAAGGAAAAAGG - Intronic
1067645470 10:48097066-48097088 ATCCAAAGCAAGAAGGAAAAAGG + Intergenic
1067700945 10:48571519-48571541 ATGCATAGAAATTAGAACAAGGG - Intronic
1068952045 10:62787334-62787356 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1069626619 10:69871823-69871845 ATGTAAAGCACTGAGCACAGCGG - Intronic
1070232975 10:74591123-74591145 ATGAAAAGCAAGTAGCTCAAGGG - Intronic
1072359161 10:94642379-94642401 ATGAAAAGCATTAACCATAAAGG - Intergenic
1073547449 10:104362954-104362976 ATGGAAAGCAACATGTACAAAGG - Intronic
1074190693 10:111133093-111133115 ATTCTAAGCAAAAAGAACAAAGG - Intergenic
1074439424 10:113461881-113461903 ATGCAAATGAATAAAAACAAAGG + Intergenic
1074463800 10:113664598-113664620 AGGCAAGGGAACAAGCACAAAGG - Intergenic
1074650128 10:115512903-115512925 AGGAAAAGGAATAAGCACAAAGG - Intronic
1074984733 10:118647759-118647781 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1075010378 10:118863804-118863826 ATCCTAAGCAAAAAGAACAAGGG - Intergenic
1075952046 10:126487368-126487390 AAGCATAACACTAAGCACAAAGG + Intronic
1076416828 10:130297246-130297268 CTGCAAAGCAATAAAAGCAAAGG - Intergenic
1078530324 11:12131879-12131901 ATGCAAAGCACTTTGCACACAGG + Intronic
1078611981 11:12828771-12828793 ATGCAAATCAATAAGAAACAAGG - Intronic
1078875929 11:15397155-15397177 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1079764288 11:24371307-24371329 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1080453260 11:32396256-32396278 ATGCACAGCAGGAAGCACACTGG - Exonic
1080841665 11:35989316-35989338 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1084386707 11:68847621-68847643 ATGCTTATCAATAAGCACAGTGG + Intergenic
1085491355 11:76921158-76921180 ATGAAAAGGATTAACCACAAAGG - Intronic
1086524488 11:87709649-87709671 ATTCAAAGGAATAATAACAAAGG - Intergenic
1086563656 11:88198517-88198539 ATTCAAACTAATAAGCACAAAGG - Intergenic
1086670065 11:89535561-89535583 AGGGAAAGCAAAAAGCAGAAAGG - Intergenic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1089108245 11:116033241-116033263 ATGCAAAGCAGGAAGCACTGAGG + Intergenic
1089260114 11:117218446-117218468 ATGGTAAGTAATCAGCACAAAGG - Exonic
1089761488 11:120727837-120727859 ATGAGAAACAAAAAGCACAAAGG + Intronic
1090023944 11:123151777-123151799 ATGCTATGAAATAAGCAAAAAGG - Intronic
1090486023 11:127112757-127112779 ATGGAAAGCCATTAGCACACTGG - Intergenic
1090524496 11:127517062-127517084 ATACAAAGAAAAAAGAACAAAGG - Intergenic
1090703926 11:129319727-129319749 ATGCAAAGCAATTAGATCAATGG + Intergenic
1093225174 12:16474420-16474442 ATGAAATCCAATAAGCACAAAGG - Intronic
1094524231 12:31221019-31221041 TAGCATAACAATAAGCACAAAGG + Intergenic
1097746025 12:63304130-63304152 AAGCCAAGCAATATGCTCAAGGG + Intergenic
1098444624 12:70553496-70553518 ATGCAGAGCAATAATCAAACTGG - Intronic
1098745084 12:74226335-74226357 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1099191203 12:79563750-79563772 ATGCAAATCAAGAAGAAAAAAGG + Intergenic
1099260898 12:80381560-80381582 AAGCCAAGCAATAAACAAAAAGG + Intergenic
1100912976 12:99386898-99386920 ATACATAGCAATAGGCACATAGG + Intronic
1101223209 12:102661801-102661823 TTGCAAATCAATAAACACAAAGG + Intergenic
1105469377 13:20678784-20678806 TTGCAAAGCGATAAAGACAAAGG + Intronic
1106966535 13:35077844-35077866 ATATATAGCAATAAGGACAAAGG + Intronic
1106980610 13:35275053-35275075 ATCCTAAGCAAAAAGGACAAAGG + Intronic
1107620075 13:42218322-42218344 GGGCAAAGCAAAAAGCTCAATGG - Intronic
1108068382 13:46602576-46602598 ATGCAAAGCTCTTAGCACAATGG + Intronic
1108347298 13:49558837-49558859 TTGCAAAGCAAAAATTACAAGGG - Intronic
1108830809 13:54475969-54475991 ATGCAAAGTAACAAGGAAAAAGG + Intergenic
1108937296 13:55899201-55899223 ATGCAAGGTAATAAATACAAAGG - Intergenic
1109017972 13:57044027-57044049 ATGAAAACCATTAACCACAAAGG + Intergenic
1109317860 13:60772537-60772559 ATTCTAAGCAAAAAGAACAAAGG - Intergenic
1109371921 13:61433336-61433358 ATGCAAAGCATTAAACACTACGG + Intergenic
1110172800 13:72522647-72522669 ATGCAGAGGAAAAAGCAAAAAGG - Intergenic
1111147805 13:84207292-84207314 TTGCAAAGTAACAATCACAATGG + Intergenic
1111436336 13:88213864-88213886 ATGCCAAAAAATAAACACAAAGG - Intergenic
1111642123 13:90981787-90981809 ATCCAAAGCAAAAAGAACAAAGG + Intergenic
1112091159 13:96085614-96085636 AAGCAGAACAATAAGCACAAAGG - Intergenic
1112190667 13:97174377-97174399 CTCCAAACCAATAAGAACAAAGG + Intergenic
1113232570 13:108230239-108230261 ATACAATGCAATAATCAAAAAGG - Exonic
1113772394 13:112918460-112918482 ATGCAACCCAACAAGGACAAGGG - Intronic
1115135429 14:30102165-30102187 ATCCTAAGCAAAAAGAACAAAGG + Intronic
1115502629 14:34063045-34063067 ATGCAAAGCACTTAGTACAGTGG + Intronic
1116164346 14:41313362-41313384 ATGCTTAGTAATATGCACAAAGG - Intergenic
1116462036 14:45188515-45188537 ATGCTATATAATAAGCACAATGG - Intronic
1116576164 14:46578409-46578431 ATTTAAAGGAATAAGTACAAAGG - Intergenic
1116640081 14:47450335-47450357 AGGCAAAGCAATCAGAAGAAAGG + Intronic
1117993595 14:61458474-61458496 ATCCAAAGCAGAAAGCATAAGGG + Intronic
1118634649 14:67736600-67736622 ATGAAAAGCAAAAAGCATATGGG + Intronic
1118866112 14:69704905-69704927 ATGCAAAGCAATAAGCACAATGG - Intronic
1119118434 14:72049468-72049490 ATAGAAAGCAGTAAGCATAAAGG - Intronic
1120304003 14:82745003-82745025 AGGAAAAACATTAAGCACAAAGG + Intergenic
1120401020 14:84031684-84031706 ATGGAAAACAATAAACATAAGGG + Intergenic
1122400565 14:101464986-101465008 ACACAAAGCAATAAACAAAAGGG - Intergenic
1122674401 14:103399301-103399323 ACTCAAAGCAATAAGAAAAATGG - Intronic
1123985390 15:25641715-25641737 TTGCAAAGCAATAAAGGCAAAGG - Intergenic
1125292551 15:38165950-38165972 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1127100609 15:55561033-55561055 ATCCCAAGCAAAAAGAACAAAGG + Intronic
1127352861 15:58170282-58170304 TTGCAAAGCAATGAGGAAAAGGG - Intronic
1127938925 15:63673406-63673428 AAGAAAAGGAATAAGTACAAAGG + Intronic
1128059948 15:64728992-64729014 TTGCAAAGTAATAAGCACATGGG + Intergenic
1128240766 15:66099670-66099692 ATGCAAAGCACCAAGTACCAGGG + Intronic
1129496346 15:75985268-75985290 ATACAAAGCAAAAACTACAAAGG + Intronic
1129645212 15:77423395-77423417 ATGCAAAGAAAACTGCACAAAGG - Intronic
1130049163 15:80468658-80468680 GTGAAAAGCAAAAACCACAATGG - Intronic
1130767873 15:86890833-86890855 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1131939876 15:97549989-97550011 ATAGAAAGCAAAAAGCAAAATGG - Intergenic
1132020646 15:98359040-98359062 ATGCACAGGAAGAAGCAAAATGG + Intergenic
1134188700 16:12104801-12104823 ATGCACAACAATAAAGACAAGGG - Intronic
1134307688 16:13047757-13047779 ATTCATAGCAATAAGCCCATAGG - Intronic
1135204689 16:20473472-20473494 AGGCAAAGCAATAAGGAATATGG + Intronic
1135245707 16:20855244-20855266 ATGTGAAGCAATAGGCACATGGG - Exonic
1136055590 16:27686679-27686701 ATACAAAGCAATCAGTTCAAAGG - Intronic
1136984887 16:35092395-35092417 AAGCAAAGCAGTAAATACAATGG - Intergenic
1137243528 16:46681693-46681715 AAGCAAAGCAGTAAATACAATGG + Intronic
1138028543 16:53541123-53541145 ATGTAAAGCATTCAGCACAGTGG + Intergenic
1138338498 16:56271335-56271357 ATGTAAAGCACTTAGCACAGAGG + Intronic
1138997013 16:62467802-62467824 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1139035650 16:62943220-62943242 ATGCAAAGCATTTAGCAAAATGG + Intergenic
1139408697 16:66740777-66740799 TGACAAAGCAGTAAGCACAAAGG + Intronic
1140738370 16:77919242-77919264 TTGCAAATCAGGAAGCACAAGGG - Intronic
1142506682 17:368505-368527 ATGGAAAGCAACTAGCAAAATGG - Intronic
1144201105 17:12943504-12943526 ATGCAAAGCATTTTGCAGAAAGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153889655 18:9501067-9501089 AAGCAAAGGAAGAAGCACATAGG - Intronic
1154003744 18:10507834-10507856 ATGCTAAGAAATAAGAACATGGG - Intergenic
1154409578 18:14130650-14130672 CTGCAAAGCAAAAAGCACAGTGG - Intronic
1155071827 18:22324025-22324047 ATTCATAGTAACAAGCACAAGGG + Intergenic
1155247017 18:23920287-23920309 AAGCAAAGCAATAACAACAAGGG + Intronic
1155780839 18:29832606-29832628 ATACACAGACATAAGCACAATGG + Intergenic
1155780901 18:29834165-29834187 ATACACAGACATAAGCACAATGG - Intergenic
1155864504 18:30948418-30948440 ATGCAAAGCATTTACAACAATGG + Intergenic
1156496605 18:37529874-37529896 ATGCAGAGCAATACCCAGAAGGG + Intronic
1156961965 18:43043318-43043340 ATGAAAACCAATTAGCACAATGG - Intronic
1157130363 18:45001717-45001739 CTGCAAAGCAAAAAGGAGAAGGG - Intronic
1158183666 18:54746766-54746788 ATGTAAAGCACTTAGCAAAATGG + Intronic
1158356252 18:56622773-56622795 ATACAAAGATATAAACACAATGG + Intronic
1159039631 18:63311662-63311684 AGGCAAAACAAGAAGCAGAATGG + Intronic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1164060320 19:21667095-21667117 TTGCAAATCAATAAAAACAAGGG + Intergenic
1165211078 19:34236335-34236357 ATACAAAGCAAAATTCACAAAGG + Intergenic
1165702143 19:37946747-37946769 AAGCAAAACAAAAAACACAAAGG - Intronic
1165871607 19:38976577-38976599 ATACAAAGCATTTAGCACAGTGG - Intergenic
1167955647 19:53061744-53061766 CTGCAAAACAATAAACACACAGG + Intergenic
1168480653 19:56717048-56717070 ATTCAAAGCCATAGGAACAATGG - Intergenic
925564372 2:5234514-5234536 ATGCAAAACAATAATAACATTGG + Intergenic
926286272 2:11491145-11491167 ATGCAAACCTATAAAAACAATGG - Intergenic
926457630 2:13087590-13087612 AAAGAAAACAATAAGCACAAAGG - Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927106662 2:19833609-19833631 ATGTAAAGCACTAAGAACAGTGG - Intergenic
927750557 2:25665961-25665983 ATGTAAAGCATTTAGCACAATGG + Intronic
927772215 2:25873128-25873150 ATGCAAAGGAATAAGAACAATGG - Intronic
928409784 2:31046043-31046065 ATGAAAAGTGATTAGCACAATGG - Intronic
930629418 2:53736071-53736093 ATTAAAAGCAATAAACATAAAGG + Intronic
930908258 2:56599822-56599844 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
932045825 2:68348671-68348693 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
932171375 2:69559960-69559982 ATGCAATCCAGTAAGCACAATGG + Intronic
933017708 2:77150660-77150682 ATGCAAAAAACTAAGCACAATGG + Intronic
934021441 2:87957767-87957789 ATGCACAACAATAAACACAAGGG - Intergenic
934911571 2:98261059-98261081 ATGCAAAACAAATAGCACAATGG - Intronic
935319527 2:101872311-101872333 ATGTTAAGCAAGAAGGACAAAGG + Intronic
937394177 2:121520263-121520285 CTGCAAAGCAAAAAACTCAAAGG + Intronic
938893582 2:135729092-135729114 CTTCAAAGCATTTAGCACAATGG + Intergenic
940595524 2:155787395-155787417 ATTCAAAGCAAAAGTCACAAAGG - Intergenic
940674511 2:156712355-156712377 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
941030255 2:160502727-160502749 ATGCACAGAAAAAAGAACAATGG + Intergenic
942923534 2:181405956-181405978 GTGGAAAGTAGTAAGCACAATGG - Intergenic
943038039 2:182770259-182770281 ATCCTAAGCAAAAAGAACAAAGG - Intronic
943057538 2:183000790-183000812 ATGCCAAGAAAAAAGCACAGTGG + Intronic
943615415 2:190086668-190086690 AAGCCAAGCAAGAACCACAATGG - Intronic
943992718 2:194717652-194717674 GTGCACAGCAGAAAGCACAATGG - Intergenic
943995898 2:194765093-194765115 ATGCTAAGCTATCAGTACAATGG + Intergenic
944644737 2:201767435-201767457 ATGAAAAGTATTAAGAACAAAGG - Intronic
945264575 2:207878264-207878286 ATGCAAAGCACTTAGAACACTGG + Intronic
945555339 2:211268672-211268694 ACTCAAAGGAAAAAGCACAAGGG - Intergenic
945804185 2:214470019-214470041 AAGCAAAGCAAAAGGCAGAATGG + Intronic
946660646 2:221995528-221995550 ATGCAAATCAAAAACCAAAATGG - Intergenic
1168922264 20:1550067-1550089 AGGCAAAGCCATAAACCCAAAGG + Intronic
1169094735 20:2887026-2887048 ATCCAAAGGAAGAAGCACTATGG - Intronic
1170754900 20:19193082-19193104 ATGAAAAGCAAAAAGAACACTGG - Intergenic
1176333481 21:5573499-5573521 ATACTAAGCAAAAAGAACAAAGG - Intergenic
1176394276 21:6247453-6247475 ATACTAAGCAAAAAGAACAAAGG + Intergenic
1176467143 21:7068721-7068743 ATACTAAGCAAAAAGAACAAAGG - Intronic
1176490704 21:7450499-7450521 ATACTAAGCAAAAAGAACAAAGG - Intergenic
1176509938 21:7687884-7687906 ATACTAAGCAAAAAGAACAAAGG + Intergenic
1177293334 21:19143685-19143707 AAACAAAACAAAAAGCACAATGG - Intergenic
1178038003 21:28606701-28606723 GTGCCAAGCAATATGCACAGTGG + Intergenic
1179657790 21:42855942-42855964 ATGCAAATCATCAAGGACAACGG + Intronic
1181146141 22:20848790-20848812 ATACAACACAAAAAGCACAAGGG + Intronic
1182733784 22:32516116-32516138 ATGAAAAGCAGTGAGCAGAATGG + Intronic
1182735003 22:32527030-32527052 ATGAAAAGCAATCAGGGCAATGG - Intronic
1183010281 22:34940889-34940911 TTCCAAAGCAATGAGCCCAAAGG + Intergenic
949228691 3:1724914-1724936 ATGCAAAGCACTCAGTACATTGG - Intergenic
949244848 3:1914941-1914963 ATTCTAAGCAAAAAGAACAAAGG - Intergenic
949439508 3:4065695-4065717 ATGCAAATCACTCAGTACAATGG - Intronic
949483359 3:4514268-4514290 TTGTAAAGCACTCAGCACAATGG + Intronic
951261179 3:20511253-20511275 ATGCAAAACAAACATCACAAAGG - Intergenic
951267053 3:20579884-20579906 ATGGAAAACAATTAGCAAAAGGG + Intergenic
951518023 3:23583373-23583395 ATGCTAAGCAAAAAGAACAAAGG - Intronic
951680436 3:25289284-25289306 GTGTAAAGCACTGAGCACAATGG + Intronic
951957330 3:28271641-28271663 ATCCTAAGCAAAAAGAACAAAGG - Intronic
951977422 3:28528264-28528286 ATCCTAAGCAAAAAGAACAAAGG - Intronic
952685518 3:36143568-36143590 ATGTAAAACAATATGCACAGAGG - Intergenic
954056033 3:48026045-48026067 ATACAAAGCAGTAAGGACACAGG - Intronic
954762225 3:52883794-52883816 AAGAAAAATAATAAGCACAATGG - Intronic
954769906 3:52957512-52957534 ATCCTAAGCAAAAAGAACAAAGG + Intronic
955908242 3:63830474-63830496 ATGCTAATTATTAAGCACAAGGG + Intronic
956353264 3:68362341-68362363 TTGCAAAGCAATAACCACAGAGG + Intronic
956567817 3:70659210-70659232 ATGAAAAGCAACCACCACAACGG - Intergenic
956739183 3:72261700-72261722 TTGCAATGCAATAAGCACCCTGG - Intergenic
956945827 3:74222219-74222241 AGGCAAAGAAAGAAGCATAAAGG - Intergenic
957462538 3:80540154-80540176 ATGGAAAGCAAATAGCAAAATGG + Intergenic
957899517 3:86470564-86470586 AAGCAAATCTATAAACACAAAGG - Intergenic
958591171 3:96159952-96159974 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
958856322 3:99390541-99390563 ATGCAAAGAGGTCAGCACAAAGG - Intergenic
959143672 3:102517523-102517545 ACGCAAATCAATAAGAAGAAAGG - Intergenic
960033247 3:113076966-113076988 AGCCAAAGCAATAAACAGAATGG + Intergenic
960115323 3:113886661-113886683 ATGCAAAGCAAGAAGAAGCAAGG + Intronic
960252903 3:115476254-115476276 ATGAAAAACAAAAACCACAAAGG + Intergenic
961742003 3:129038966-129038988 ATGCTAAGCATGAAGCACACTGG - Intronic
961998477 3:131270713-131270735 ATGCTAAGCCTTAAGCCCAAGGG - Intronic
963093073 3:141504840-141504862 CTACAAAGCAATAAGCAAAGTGG - Intronic
963775010 3:149429703-149429725 ATACAAAGCTTTATGCACAAAGG - Intergenic
964047139 3:152342406-152342428 ATGCCAAGCACTTAGCACAATGG + Intronic
967332926 3:188309960-188309982 ATTTAAAGAAATAAGGACAATGG - Intronic
967600791 3:191386064-191386086 ATCCTAAGCAATAAGAACAAAGG - Intronic
969895174 4:10296977-10296999 TTGCAAAGCAATTAAGACAAAGG + Intergenic
969911607 4:10452336-10452358 ATGCAAAGCATTAAGCCCAATGG + Intronic
970054253 4:11952671-11952693 ATCCAAGGCAGTAAGCAAAAGGG + Intergenic
971090181 4:23334115-23334137 ATGGAAAGCACTTAACACAATGG - Intergenic
971368606 4:25997020-25997042 ATGTAAAGAATTAAGTACAATGG - Intergenic
971643064 4:29160050-29160072 ATGCATAGCAGTAAGCATAAAGG - Intergenic
971741627 4:30528672-30528694 ATTCAAGGCAATCAGCACAGGGG - Intergenic
973775108 4:54234635-54234657 ATGCAAAGCATTAACAACCAAGG - Intronic
974261063 4:59524380-59524402 ATCCCAAGCAAAAAGAACAAAGG - Intergenic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
974946382 4:68534261-68534283 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
975534190 4:75432176-75432198 GTGCAAAGCACTTAGAACAAGGG + Intergenic
975796182 4:78008866-78008888 ATGCAAAGGAGAAAGCATAAAGG - Intergenic
976985136 4:91285109-91285131 ATGAAAAGAAATAAGAGCAAAGG - Intronic
977148475 4:93477771-93477793 ATGCAAAGCAATTAGTGCAATGG + Intronic
977508341 4:97930622-97930644 ATCCTAAGCAAAAAGAACAAAGG - Intronic
977642483 4:99372583-99372605 TTGCAAAGCAATAAAAGCAAAGG - Intergenic
977669118 4:99675476-99675498 ATGCTAAGCAATAAGAACAAAGG + Intergenic
977773664 4:100891486-100891508 ATGCAAAGAAGAAATCACAATGG + Intergenic
978330354 4:107605872-107605894 ATGCAAAGCACTTTGCACAATGG + Intronic
978764648 4:112391663-112391685 CTGCAGATCAAGAAGCACAAGGG + Intronic
978929327 4:114291710-114291732 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
979458161 4:120949761-120949783 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
980230595 4:130041476-130041498 AGCCAAAGCAAAAAGCACATAGG + Intergenic
980379598 4:131994838-131994860 ATGCAAAGGTATAAGAATAATGG - Intergenic
981951725 4:150417644-150417666 ATTCAAAGCAATAATTATAATGG + Intronic
982031442 4:151305220-151305242 ATGCAAAGAAATAAGAAATATGG + Intronic
982281613 4:153688892-153688914 TTGCAAAGCAATAAAAGCAAAGG + Intergenic
984060447 4:174983349-174983371 TTGCAAAGCAATAAAGGCAAAGG + Intergenic
984087619 4:175331903-175331925 ATGATAAGCAAGAAGCACACTGG + Intergenic
984108578 4:175580774-175580796 CTTCACAGCAATAAGCAAAATGG - Intergenic
985845202 5:2339487-2339509 GTGCAAAGCAATCAATACAAAGG - Intergenic
986702270 5:10422201-10422223 ATGCAAAGCACTGGGCAAAACGG + Intronic
986784275 5:11097611-11097633 ATCCAAAGGAATAAGCAAAGGGG + Intronic
987554619 5:19431066-19431088 ATGCAAAGGCATAAGAACGATGG - Intergenic
988220004 5:28332663-28332685 ATGCAAAACTATCATCACAAAGG - Intergenic
988367383 5:30318102-30318124 ATGCAAAGTAAGGAGCAAAATGG - Intergenic
989706665 5:44341051-44341073 ATGCTAAAAAATAAGAACAAAGG - Intronic
990286391 5:54304325-54304347 ATGCAAAGCACTTAGAACACTGG + Intronic
990638277 5:57753903-57753925 GTAGAAAGCAATAAGCACTAGGG - Intergenic
991156859 5:63447399-63447421 ATGCAGAGGTATCAGCACAATGG - Intergenic
991177814 5:63710795-63710817 ATTCAAGGAAATAAGGACAAAGG + Intergenic
993063294 5:83067395-83067417 ATGCTAAGCAGTAGGCAAAAGGG + Intronic
994681842 5:102897635-102897657 AGCCAAAGAAATAAGCAAAAGGG + Intronic
995005454 5:107188876-107188898 ATCCAAAGCAAGTAGCAAAAAGG + Intergenic
996515310 5:124362936-124362958 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
996641989 5:125766234-125766256 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
997005138 5:129807553-129807575 ATGCATATCATTAAGCACAGAGG + Intergenic
997129053 5:131258113-131258135 AGGGAAAGCAAGAACCACAATGG - Intronic
997911832 5:137882190-137882212 TTGCAAAGCAGTACGTACAATGG + Intronic
998578385 5:143343122-143343144 ATGGAAAGTGACAAGCACAATGG + Intronic
998715130 5:144874711-144874733 ATGCAAACACATAAGCAAAATGG - Intergenic
999078879 5:148824883-148824905 ATGAAAAGCAAATAGCAGAATGG + Intergenic
999505389 5:152189574-152189596 ATGAAAAGCATTCAGCACAATGG + Intergenic
999580357 5:153031602-153031624 ATGCAAAGCAACACTCACAGTGG - Intergenic
1000323388 5:160153127-160153149 ATGCAAATTAAAAACCACAATGG - Intergenic
1000729657 5:164817469-164817491 ACACAAAGCATTAACCACAAAGG + Intergenic
1001019959 5:168174431-168174453 ATGCAAAACAGTCAGCACAACGG + Intronic
1001610657 5:172998779-172998801 CTTCAAAGCAATAAAAACAAAGG - Intronic
1001808116 5:174606464-174606486 AAGAAAAGCACTAAGCACAGCGG + Intergenic
1002007771 5:176250784-176250806 ATGGAAAGCAAAAAACAAAAAGG - Intronic
1002203179 5:177543348-177543370 ATACAAAGCACTTAGCTCAAGGG + Intronic
1002387489 5:178879345-178879367 CTGCAAAGAAATCAGCACACAGG - Intronic
1003373770 6:5554647-5554669 AGGCAAAGCATTTAGCTCAATGG - Intronic
1004195010 6:13495645-13495667 AGGCAGATCAATAAGCACATAGG + Intergenic
1004474984 6:15962985-15963007 ACGGAAAACAATAAGAACAAAGG + Intergenic
1004556546 6:16704024-16704046 AAACAAAGCAATAACAACAACGG + Intronic
1005210965 6:23462355-23462377 ATGCAAAACTAGAAGCAAAAGGG + Intergenic
1006029984 6:31171395-31171417 ATCAACAGCCATAAGCACAATGG + Intronic
1007648813 6:43403808-43403830 AAGCCAAGCAATCAGCGCAATGG - Intergenic
1008421587 6:51306704-51306726 AGGCAAAACAACAAGCACAAAGG - Intergenic
1008486560 6:52042314-52042336 ATCCAAAGCATTAAGGAAAAGGG + Intronic
1009168196 6:60366235-60366257 ATTCAAAGCATTAATCAAAAAGG + Intergenic
1009955275 6:70445887-70445909 TTGCAAAGCAATAAAAGCAAAGG + Intronic
1010138609 6:72585999-72586021 ATAAAAAGCACTAACCACAAAGG - Intergenic
1010806344 6:80241472-80241494 AGGAAAACCAACAAGCACAAAGG - Intronic
1010820465 6:80409746-80409768 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
1011147821 6:84238192-84238214 ATACTAAGCAAAAAGAACAAAGG + Intergenic
1011230461 6:85155567-85155589 GTTCACAGCAGTAAGCACAATGG + Intergenic
1012710221 6:102590909-102590931 ATTCTCAGCAATAAGAACAAAGG + Intergenic
1012799469 6:103806532-103806554 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1012895102 6:104938703-104938725 ATGAAAAGCCATAAGAACAAAGG - Intergenic
1012985101 6:105867297-105867319 ATAAAAAGGAATAAGAACAAAGG + Intergenic
1013033928 6:106361685-106361707 ATAAAAATCAAAAAGCACAATGG - Intergenic
1013386820 6:109640092-109640114 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1013475696 6:110505519-110505541 GTGCAAATCAATAAACTCAAAGG - Intergenic
1013519756 6:110922564-110922586 TTGCAAAGCAATAAAAGCAAAGG - Intergenic
1013536457 6:111067173-111067195 ATGCAAAGCAACTAGCTCAGAGG - Intergenic
1013786190 6:113784066-113784088 TTGCAATGCAATGAGCATAAGGG - Intergenic
1013896786 6:115098618-115098640 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1015006913 6:128293990-128294012 ATCTACAGCTATAAGCACAAAGG - Intronic
1015110205 6:129584113-129584135 CTGCAAAGCAATAATGACACTGG + Intronic
1015657171 6:135532045-135532067 ATGCAGAGTAATAAGAGCAATGG - Intergenic
1015945658 6:138497929-138497951 ATACTAAGCAGAAAGCACAATGG - Intronic
1017200513 6:151749056-151749078 ATATAAATCAATAAGCATAATGG + Intronic
1018255428 6:161913544-161913566 ATAAAAAGCAATAACCAGAATGG + Intronic
1021390054 7:20081660-20081682 ATGCAAATTAATTAGCACAGTGG - Intergenic
1021459078 7:20865438-20865460 ATGTAAAGCATTTAGAACAATGG - Intergenic
1022498667 7:30868989-30869011 TTTCAATCCAATAAGCACAAAGG - Intronic
1022750649 7:33220492-33220514 ATACATAGCAATCACCACAATGG - Intronic
1022807008 7:33832365-33832387 AAGCAAAGTAATAGGCAGAAGGG - Intergenic
1023587229 7:41743384-41743406 ATGCAAAGCAATTAGCAGAGAGG + Intergenic
1023877796 7:44298150-44298172 ATACAAAACAATAATCAAAATGG + Intronic
1025001381 7:55317966-55317988 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1025017922 7:55455499-55455521 ATTCTAAGCAAAAAGAACAAAGG + Intronic
1026341851 7:69441215-69441237 ATGCAAACTAATCAGGACAAGGG + Intergenic
1026634141 7:72066540-72066562 TTGTAAAGCAGTAAGCAGAAAGG - Intronic
1027112422 7:75451222-75451244 ATACTAAGCAAAAAGAACAAAGG + Intronic
1027284667 7:76635828-76635850 ATACTAAGCAAAAAGAACAAAGG + Intergenic
1028514229 7:91658746-91658768 AGGCCAAGCAATATGCAAAAGGG - Intergenic
1029721506 7:102368082-102368104 CTTCAAAACAATAAGCACACAGG - Intronic
1030679284 7:112417678-112417700 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1030980946 7:116185287-116185309 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1031551572 7:123120321-123120343 ATGCAAAACAATAAGAACAGTGG - Intronic
1031907989 7:127482196-127482218 ATGCAGAGCAATATGTTCAAAGG + Intergenic
1032393699 7:131574046-131574068 AAGCAAACAAAAAAGCACAATGG - Intergenic
1032550296 7:132778447-132778469 TTGGAGAGCAGTAAGCACAAAGG - Intergenic
1032730228 7:134634369-134634391 ATGCAAAGTAATAAGCTCATAGG - Intergenic
1034430191 7:151037398-151037420 ACGCAAAGCAATAAGCTATAAGG - Intronic
1034991080 7:155548580-155548602 GGCCAAAGCAATCAGCACAAAGG + Intergenic
1035930383 8:3773884-3773906 ATGCAAACCAATAAACAAACTGG + Intronic
1037744538 8:21632299-21632321 CTGGAAAACACTAAGCACAAAGG + Intergenic
1037791559 8:21947676-21947698 AAGCAAAGCACTAATCATAAAGG + Intronic
1038163815 8:25065443-25065465 AAGCAAAGCACTAGGCAGAAAGG + Intergenic
1038859503 8:31371600-31371622 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1039175754 8:34803904-34803926 ATGTAAAGCAATAATTAAAATGG - Intergenic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1040955982 8:52980369-52980391 TTGCAAAGCGATAAGAGCAAAGG + Intergenic
1042401932 8:68359781-68359803 ATGAAATACCATAAGCACAAAGG + Intronic
1042438484 8:68796291-68796313 CTGAAAAGCAATAAGAACAATGG - Intronic
1043626564 8:82268111-82268133 ATGCTAAGCATTAAGCAAAATGG + Intergenic
1045724626 8:105158119-105158141 ATGCAAAACAATCAGCTGAAGGG + Intronic
1046162628 8:110387338-110387360 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1047575368 8:126148502-126148524 ATGCAAAGAAACAAGAACACTGG - Intergenic
1047979835 8:130169583-130169605 ATTCAAAGCAATAATACCAACGG + Intronic
1047992420 8:130299749-130299771 ATCCAAAGGAATAACAACAAAGG + Intronic
1048622503 8:136149582-136149604 AAGCAAAGAAACAAGCACAAAGG - Intergenic
1048830292 8:138469885-138469907 ATGCAAGGCAACTAGCACATCGG + Intronic
1050037456 9:1452232-1452254 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1050053372 9:1626086-1626108 ATGAAAAGCAACTAGCAAAATGG + Intergenic
1051056021 9:12987064-12987086 ATGGGAAGCAAGAAGCACATTGG + Intergenic
1051306418 9:15714928-15714950 AGTCAAAGCAATAAACAAAATGG - Intronic
1051593967 9:18805513-18805535 ATGCAAAGCTGTAAGAACAACGG - Intronic
1052240956 9:26272899-26272921 ATGCAGAGCAATAAACAACACGG - Intergenic
1052647263 9:31253208-31253230 ATGCAAAGATGTAAGCCCAATGG + Intergenic
1053058540 9:35009375-35009397 ATGCAAAGCAAAAAAGAGAATGG + Intergenic
1053488090 9:38476902-38476924 ATGGAAAGCAAAGAGCACAGGGG + Intergenic
1054979531 9:71188871-71188893 ATATAAAGTAATAAGCACAGTGG + Intronic
1055101890 9:72474349-72474371 CTGTAAAGCATTAAGCACAGTGG - Intergenic
1057003339 9:91533269-91533291 ATGCATAGCTTTAAGCACTATGG + Intergenic
1057460734 9:95259237-95259259 ATCCTAAGCAAAAAGAACAAAGG + Intronic
1057668459 9:97066175-97066197 ATGGAAAGCAAAGAGCACAGGGG + Intergenic
1057710601 9:97439436-97439458 ATGCAAAGCAATTAGGAAAAAGG - Intronic
1058471141 9:105280162-105280184 ATTCTAAGCAAGAAGCATAAAGG + Intronic
1059089499 9:111340785-111340807 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1059123008 9:111659525-111659547 ATGCAAAGAAAAGAGGACAAAGG - Intronic
1059140647 9:111849765-111849787 ATGAAAGGCAAGAAGCCCAAGGG - Intergenic
1059242325 9:112817668-112817690 ATGGAAAAAAATAAGCATAAGGG - Intronic
1059812897 9:117876290-117876312 GTGCAAATCAATAAGCACTCTGG + Intergenic
1060456152 9:123800244-123800266 AAGCAAAGGAATTAGCAGAAGGG - Intronic
1203428216 Un_GL000195v1:61723-61745 ATACTAAGCAAAAAGAACAAAGG + Intergenic
1185957798 X:4511206-4511228 AGGCAAAGAAATATGAACAAGGG + Intergenic
1186335074 X:8577733-8577755 AGGCAAAGTAACAAGCACGAAGG + Intronic
1186402363 X:9271507-9271529 AGGCAAAGCAAAAAGCACAAGGG + Intergenic
1186406377 X:9307627-9307649 ATGCACAGAAAAAAGCACAAAGG + Intergenic
1186649080 X:11539855-11539877 ATGAAAATCAATAAGCTTAATGG + Intronic
1187754298 X:22503571-22503593 CTGCAAATCAATGAGAACAAGGG - Intergenic
1187804049 X:23098734-23098756 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1187946787 X:24433876-24433898 AGGGAAAGCTATAAGGACAAAGG + Intergenic
1188098540 X:26052846-26052868 ATGTAGAGAAAGAAGCACAAGGG + Intergenic
1188717900 X:33483406-33483428 ATGCATAGCAATCAGCAAATAGG + Intergenic
1191164821 X:57377590-57377612 ATCCAAAGCAAAAAGAACAAAGG - Intronic
1191274671 X:58528297-58528319 ATGGAAAGCAAACATCACAAAGG - Intergenic
1192536497 X:71932930-71932952 ATGGAAAAGAAAAAGCACAAGGG - Intergenic
1192663427 X:73066599-73066621 AGTCAAAGCAAAAATCACAAGGG + Intergenic
1193314447 X:80047741-80047763 TTGCAAAGCAATAAAAGCAAAGG - Intergenic
1193550071 X:82881037-82881059 ATGCAAAGGAAAAACCAAAAAGG + Intergenic
1193634821 X:83936279-83936301 ATCCCAAGCAAAAAGAACAAAGG - Intergenic
1193858669 X:86637959-86637981 ATCCTAAGCAAAAAGAACAAGGG + Intronic
1194455381 X:94096491-94096513 ATTCAAATAAATAAGCAAAATGG + Intergenic
1194514921 X:94840645-94840667 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1194782713 X:98044821-98044843 ATCCCAAGCAAAAAGAACAAAGG - Intergenic
1195140535 X:101954879-101954901 ATCCTAAGCAAAAAGAACAAGGG + Intergenic
1195787051 X:108537581-108537603 ATGCAAAGCAATAACCTGACAGG - Intronic
1196406723 X:115370652-115370674 AGGCAAAGTAATAAGCACAATGG - Intergenic
1196934366 X:120715009-120715031 ATGTAAAGCACTTAGCATAATGG + Intergenic
1198013597 X:132585657-132585679 ATGTAAAGCAATTAGCACAGTGG + Intergenic
1198894254 X:141433815-141433837 ATGCTGTGCAATAAACACAATGG - Intergenic
1199123083 X:144081351-144081373 AGGCACAACAATAAACACAAGGG + Intergenic
1199766338 X:150944332-150944354 ATGCAAATCAATGAGCTCAGTGG + Intergenic
1199883389 X:151994855-151994877 TTGGAAAGAAATAAGCTCAAAGG + Intergenic
1199896270 X:152130577-152130599 ATGCAATGCAAAAAGCTGAAGGG - Intergenic
1201732670 Y:17221814-17221836 AAGCAAAGAAAATAGCACAAAGG + Intergenic
1201892848 Y:18961717-18961739 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1202586018 Y:26428456-26428478 ACTAAAAGCAAAAAGCACAATGG - Intergenic