ID: 1118866436

View in Genome Browser
Species Human (GRCh38)
Location 14:69707896-69707918
Sequence TGAGGCAATGGGAGTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118866431_1118866436 10 Left 1118866431 14:69707863-69707885 CCTGAAAGTCTGGATAGTGGTTA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1118866436 14:69707896-69707918 TGAGGCAATGGGAGTGATTTTGG 0: 1
1: 0
2: 2
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118866436 Original CRISPR TGAGGCAATGGGAGTGATTT TGG Intronic
900735863 1:4299215-4299237 TCAGGCAATTGGAGTAATTCAGG - Intergenic
901798317 1:11692792-11692814 TGGGGCTCTGGGAGTGATCTCGG + Intronic
902080300 1:13816075-13816097 TGATGCAATCGGAGTCATTCTGG + Intronic
903661852 1:24983266-24983288 TGAGGCCATGGTGGTGGTTTGGG + Intergenic
905645734 1:39624040-39624062 TGAGGCCAGGGCAGTGATCTGGG + Intergenic
906647309 1:47484432-47484454 TGAGTCAATTGGATTGAGTTTGG - Intergenic
907965408 1:59324094-59324116 TCAGGCAATGTGAATGACTTAGG - Intronic
908079968 1:60566444-60566466 TGAGGCAAAGGGTGGGAATTTGG - Intergenic
910723267 1:90311167-90311189 TGAGGCAAGGGGATTGCTTGAGG - Intergenic
918449917 1:184648148-184648170 TTAGGCACTGGGTCTGATTTAGG - Intergenic
919942263 1:202296300-202296322 TGTGGAAATGTGACTGATTTGGG - Intronic
919952606 1:202379007-202379029 TGAGGCCATGGGAGTGGGTAAGG - Intronic
920198237 1:204243513-204243535 CGAGGCAATGAGAGAGCTTTGGG - Intronic
920242147 1:204560887-204560909 TGAGGCCATGGCAGTAATCTGGG + Intergenic
920646782 1:207809563-207809585 TGCAGCAAGGAGAGTGATTTGGG - Intergenic
923660607 1:235954146-235954168 CTAGGCAATGGGAGAGAGTTTGG + Intergenic
1062926651 10:1321127-1321149 AGAGCCAATGGGATGGATTTGGG - Intronic
1063301027 10:4848955-4848977 TGAGGCAATGGCAATGATACTGG - Intergenic
1063402558 10:5760735-5760757 TATGGGAATGGGTGTGATTTGGG + Intronic
1063810309 10:9697424-9697446 AGAGGCAATGGAAGTGATGGAGG + Intergenic
1065867634 10:29927585-29927607 TGAGGCCATAGGACTAATTTTGG + Intergenic
1066046482 10:31599901-31599923 TGAGGCAGTGGGAGGAATGTCGG - Intergenic
1068905683 10:62319027-62319049 TAAGGAAATGGAATTGATTTTGG + Intergenic
1069075812 10:64037367-64037389 TGAGGTTATGGGAGTTATTGTGG + Intergenic
1071596721 10:86933269-86933291 TGGGGAGATGGGAGTGATTTGGG - Intergenic
1074484497 10:113861133-113861155 TAAGGCAATGGAAATGATTAAGG + Intronic
1074862868 10:117525509-117525531 AGAGACAATGGAAGAGATTTGGG + Intergenic
1075618649 10:123909790-123909812 AGAGACAATGGAGGTGATTTGGG + Intronic
1075817012 10:125272088-125272110 TGAGGCAATCTCAGTTATTTTGG + Intergenic
1077094907 11:795179-795201 TGAGGGAATGGGAATGAGTGAGG + Intronic
1079201870 11:18383541-18383563 TGAGGAAAGGGGAGGAATTTGGG + Intergenic
1079929237 11:26537274-26537296 TGTGGCTATGGAAGTCATTTGGG + Intronic
1081980132 11:47261135-47261157 TGGGGCAAAGGGGGTGGTTTGGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083208044 11:61165260-61165282 TGAGGTATTGCGAGAGATTTGGG + Intergenic
1084180892 11:67445316-67445338 TGTGGCAATGGGAATGAGATGGG - Intergenic
1085583747 11:77680340-77680362 TGAGGCAATAGGACTGCTTGTGG + Intronic
1088124795 11:106411707-106411729 GGAAGCAATGGGTGTGATGTGGG - Intergenic
1089374874 11:117987010-117987032 GGGGGCAGTGGGAGTGAGTTGGG - Intronic
1089649547 11:119903771-119903793 GGAGGCAAGGGGAGGGATTATGG - Intergenic
1091209047 11:133841408-133841430 TGCGGCTAAGGGAGAGATTTAGG - Intronic
1092226495 12:6751732-6751754 TGAGGCCATGGGCCTGGTTTGGG - Intronic
1096701121 12:53383446-53383468 TGAGGCAATGGGTGTGAGAGTGG - Exonic
1098083346 12:66813516-66813538 TGATGCAATGGAAGTGACTCTGG + Intergenic
1098432445 12:70434651-70434673 TCAGACAATGGGAGTCATTTCGG - Intergenic
1098554675 12:71804697-71804719 GGAGCCAATGAGAGTGCTTTTGG - Intergenic
1101685605 12:107016990-107017012 GGAGGCAATGGCAGTTATTTAGG - Intronic
1101964556 12:109273602-109273624 TCAGGCAGTGGGAGTGAGATGGG - Intergenic
1102072189 12:110029715-110029737 TCAGGGAATTGGAGTGCTTTAGG + Intronic
1102233196 12:111277571-111277593 TGAGGCAACTGGAGTGAGATGGG - Intronic
1102462850 12:113110685-113110707 TGAGGCAAGGGGACTGCTTGAGG + Intronic
1103256249 12:119543869-119543891 TGAGGCTATGGCAATGATTGTGG + Intergenic
1103358624 12:120340744-120340766 TGAGGCAAAAGGAGTGCTTGAGG - Intergenic
1103734349 12:123049638-123049660 TGTGGCAATGGGACTGAACTGGG - Intronic
1106148382 13:27073172-27073194 TGAGGCAATGAGAGTGAGACAGG + Intronic
1107669670 13:42731956-42731978 TGAGCCAATGTGAGTGACTATGG + Intergenic
1109452505 13:62535969-62535991 TGATGGAATAGGAGTTATTTGGG - Intergenic
1115777682 14:36734095-36734117 TCATGAAATGGGAATGATTTAGG + Intronic
1118168476 14:63361314-63361336 TGATGAGATGGGATTGATTTTGG + Intergenic
1118866436 14:69707896-69707918 TGAGGCAATGGGAGTGATTTTGG + Intronic
1121059912 14:90897307-90897329 TAAGCCAATGGGCCTGATTTTGG + Intronic
1125708940 15:41767842-41767864 TGAGGGAATGGGAGCTACTTAGG - Exonic
1127312994 15:57768976-57768998 TGAGCCAATGGGAGTCAGATGGG + Intronic
1128364166 15:66985386-66985408 TGTGGCAATGGGAGAGGTTTGGG + Intergenic
1131880086 15:96852908-96852930 TGAGGTAATTGGAGGGATTGAGG + Intergenic
1133047641 16:3097795-3097817 TTAGGGAATGGCAGTGATTCTGG + Intronic
1133077961 16:3294642-3294664 AGAGGCACTGGGAATGATCTAGG + Intronic
1133150484 16:3824849-3824871 TGAGGCACAGGGAGTGATTGAGG - Intronic
1133252914 16:4496019-4496041 TGAGCCAAGGTGAGTGTTTTAGG + Intronic
1134136344 16:11678668-11678690 TGAGGCACTGGGGGGGTTTTCGG + Exonic
1138566201 16:57834747-57834769 TGAGGCAAGGGGATTGCTTGAGG - Intronic
1142114775 16:88350921-88350943 GGAAGCAGTGAGAGTGATTTTGG + Intergenic
1143784917 17:9248911-9248933 AGAGGCAATGGGTGTGCTTCTGG + Intergenic
1145738975 17:27256131-27256153 AGAGGCAATGGGATGGGTTTTGG - Intergenic
1146013814 17:29216783-29216805 ACAGGCATTGGGAGTGATTGGGG + Intergenic
1148459803 17:47832857-47832879 TTAGGCATTGGGATTTATTTGGG - Intronic
1149892042 17:60398743-60398765 TGAGGCAAGAGGATTGATTGAGG + Intronic
1150692218 17:67376914-67376936 AGAGGCAATGGGTGGGATTTGGG - Intergenic
1153692253 18:7605752-7605774 TGAGGCTGTGGTAGTGATTTGGG + Intronic
1153815573 18:8787156-8787178 TCAGAAACTGGGAGTGATTTGGG + Intronic
1154040041 18:10845990-10846012 TGAGGCAGTGGGAGTGCCGTGGG + Intronic
1156154962 18:34290850-34290872 TGAGGCAAAGGGAATAATTTGGG + Intergenic
1156188964 18:34696646-34696668 TGAGGCAATGGCAGTGCATGAGG - Intronic
1156992358 18:43424726-43424748 TGAGGGAATTGAAGTGTTTTAGG + Intergenic
1158302087 18:56063659-56063681 TGGGGCTATAGGAGGGATTTGGG - Intergenic
1160062565 18:75546369-75546391 TGAGGGAATGGGAGTGACGATGG + Intergenic
1160598090 18:79991276-79991298 TGAGGGAATGGGAGGGAAATGGG - Intronic
1161990094 19:7679851-7679873 TGGGGCAAGGGGAGGGGTTTTGG + Intronic
1165184335 19:34003924-34003946 TGAGCAAAGGGGACTGATTTGGG + Intergenic
1167674175 19:50874413-50874435 TGGGTCATTTGGAGTGATTTGGG - Intronic
1168471881 19:56646694-56646716 TGAGGTAAGTGGAGAGATTTGGG + Intronic
1168502234 19:56902767-56902789 CGTGGCAATGGGAGACATTTAGG + Intergenic
925559614 2:5176124-5176146 TCAGGCAATGGTAGTAAGTTTGG + Intergenic
926934919 2:18077278-18077300 TGAGTCAATGAGAGTGAGTCTGG - Intronic
927015074 2:18951115-18951137 TGTGCCAAGGGAAGTGATTTTGG + Intergenic
927253324 2:21017982-21018004 TTAGGGAATGGGAGAAATTTAGG - Intronic
928717310 2:34075699-34075721 TTAGACAAAGGGAGTGATTTGGG + Intergenic
929660659 2:43780818-43780840 TGAGGCAATGGGAGGGAAGATGG + Intronic
930047205 2:47183234-47183256 TGAGGAAATAGGAGTCACTTAGG + Intergenic
931969115 2:67566537-67566559 TGAGGCTGTGTGAGTGACTTTGG - Intergenic
932248576 2:70219693-70219715 ACAGGCAATGGGAGGGATTCGGG + Intronic
932638948 2:73422313-73422335 TGAGAGAATGGGAGTGAATAAGG + Intronic
933440473 2:82307082-82307104 TGAAGCAATGGGAGTGAAGAAGG + Intergenic
934669959 2:96205474-96205496 TGAGCCAAAGGCTGTGATTTAGG + Intronic
935850515 2:107214056-107214078 TGAGCCAATGTGAGTGATCATGG + Intergenic
936690416 2:114881249-114881271 TGGGGCAATGGGAGCTATTGGGG + Intronic
938242599 2:129754925-129754947 TGAGGCAATGGCTGTGAATAAGG + Intergenic
938943046 2:136186298-136186320 AGAGGCAGGGGGAGTGATCTTGG - Intergenic
939958884 2:148549000-148549022 AGCAGCAATGGGAATGATTTTGG + Intergenic
940098947 2:150011220-150011242 TTAGCCAAAGGGAGTAATTTGGG - Intergenic
940642627 2:156362404-156362426 TATGACAATGGGAGTGATTGAGG - Intergenic
940818733 2:158327558-158327580 TCAGTCAATGGATGTGATTTGGG - Intronic
940908251 2:159187741-159187763 TGAAACAATGTGAGTGATTCGGG - Intronic
941163730 2:162063391-162063413 TGAGGCCATGGGAGTGGATGAGG + Intronic
946559393 2:220896011-220896033 TAAGGCAAATGGAGTGAATTTGG - Intergenic
946978642 2:225181653-225181675 TGAGGCAGGGGGATTGATTGAGG + Intergenic
947390789 2:229637133-229637155 TGAGGGGATGGGAGTGGGTTGGG - Intronic
947856488 2:233327929-233327951 TCAGGCAATGGGAAAGTTTTGGG - Intronic
948351850 2:237347443-237347465 CCAGGCAATGGGAGTGAATGAGG - Intronic
1169326833 20:4683489-4683511 AGAGGCAATGGGAGTGAGTTTGG + Intergenic
1169815789 20:9654766-9654788 TAAGGTAATGGGAGTGACTAAGG - Intronic
1171321847 20:24252595-24252617 TGAGGCTTTGTGAGTGTTTTTGG - Intergenic
1172273224 20:33666338-33666360 AGAGCCAAGGGCAGTGATTTTGG - Intronic
1173419078 20:42884596-42884618 TGAGGCCATGGGAGTGGTTGAGG + Intronic
1175151653 20:56939897-56939919 AGAAGCAAGGGGAGTGATTTGGG - Intergenic
1175353956 20:58347289-58347311 TAAGTCAATGAAAGTGATTTTGG + Intronic
1176160406 20:63644701-63644723 TGAGGCATTCGGAGGGAATTAGG + Intronic
1177491768 21:21834991-21835013 TAACGCAATGAGAGTCATTTAGG - Intergenic
1177692585 21:24530947-24530969 TGAGACAATGAGAGTAATCTGGG - Intergenic
1178414027 21:32389321-32389343 TGAAGCAATGGAAATGACTTTGG + Intronic
1182307505 22:29380896-29380918 TGAGGCCATGGTAGGGACTTTGG - Intronic
949894632 3:8760093-8760115 TGATGGAGTGGGAGTCATTTTGG - Intronic
950228828 3:11258402-11258424 TGAGGCCATGAGAGTCATCTTGG - Intronic
953042733 3:39269301-39269323 TAAGGCAAAGGGCCTGATTTGGG - Intronic
953091118 3:39726918-39726940 CAAGGCCATGGGATTGATTTAGG + Intergenic
953261343 3:41342000-41342022 CGAGTCAATTGAAGTGATTTTGG + Intronic
953388432 3:42520522-42520544 GGAGGGAATGGGAGTGAGTGAGG + Intronic
953453198 3:43021070-43021092 GGAGGCAATGGCAGGGAGTTTGG + Intronic
957795980 3:85008095-85008117 TGAGCCAATGGCAGTGTTTTAGG - Intronic
958455851 3:94329846-94329868 TGAGAAAGTGGGAGTGATTATGG + Intergenic
960099368 3:113723824-113723846 TGAGGAAATGGGAGTGGTCTAGG - Intronic
960221774 3:115120479-115120501 TGAGTCAATAGGAGTTATTTTGG + Intronic
960620777 3:119635067-119635089 TAAGGCAATGGTATTCATTTAGG - Intergenic
960818030 3:121693641-121693663 TTAGACAATGGGACTAATTTTGG - Intronic
963628006 3:147697455-147697477 TGAGGAAATGCAAATGATTTGGG + Intergenic
964428125 3:156574616-156574638 TGAGGCATTGGGAGGCATTGGGG - Intergenic
967188794 3:186967610-186967632 AGTGGCAGAGGGAGTGATTTGGG + Intronic
967241409 3:187443274-187443296 AGAGACAATGGTAGTGTTTTAGG + Intergenic
970906862 4:21226177-21226199 TGAGGCAAAGGGATTGTTTGAGG + Intronic
971749360 4:30626580-30626602 ATAGGCAATGGGAGAGAATTGGG - Intergenic
975028483 4:69582624-69582646 TGAGGTAATAGGAGATATTTTGG - Intergenic
975937794 4:79602289-79602311 TGAGGGAAGGGAAGTGGTTTAGG - Intergenic
976399082 4:84587447-84587469 AAAAGCAATGGGAGTGATTTAGG + Intronic
982128689 4:152206938-152206960 TGAGGCAATGTGTGTGGCTTTGG - Intergenic
982155728 4:152518527-152518549 TGAGGCAAAAGGATTGCTTTAGG - Intronic
982326742 4:154136562-154136584 AGAGGCAGGGGGAGTGCTTTGGG + Intergenic
982724200 4:158888205-158888227 GGAGGCAATTGGATTGATTCAGG + Intronic
985817884 5:2140106-2140128 TGGGGCAAGGGGAGTGCTTTGGG - Intergenic
987191214 5:15480367-15480389 TAAGGCAATGGAAGTGTTTCTGG + Intergenic
989589970 5:43104232-43104254 TTAGGAAATGGGAGTGCTTGTGG + Intronic
991971481 5:72146008-72146030 AGACGCATTGGGAGTGATTTTGG + Intronic
993126691 5:83844324-83844346 TGAGGCAATGAGAGTGAGATCGG - Intergenic
994227943 5:97275746-97275768 TGAGGCCATTGGAGTGAGTGAGG - Intergenic
995023353 5:107391624-107391646 TGAGTAAATGGGTGTGAATTTGG - Intronic
995454578 5:112337996-112338018 GGAGGCAAGGCGAGCGATTTAGG - Intronic
996689928 5:126329475-126329497 TGAGGCAATCAGAATGCTTTTGG + Intergenic
996876077 5:128242081-128242103 AAAAGCAATGGTAGTGATTTGGG + Intergenic
998382654 5:141736671-141736693 GGAAGCCATGAGAGTGATTTGGG - Intergenic
1000108302 5:158082049-158082071 TTAGGTATAGGGAGTGATTTGGG + Intergenic
1000208307 5:159083948-159083970 TGAGGCCATGGAAGTTAATTTGG + Intronic
1000729682 5:164817877-164817899 TGTGGCAAAGGGAGTTACTTTGG + Intergenic
1002858868 6:1062061-1062083 AGAGGCAGTGGGAGTGGTTGGGG - Intergenic
1003937235 6:10988048-10988070 GGAAGCTAAGGGAGTGATTTTGG - Intronic
1004364915 6:15003777-15003799 TGAGAGAATGGGAGGGAATTGGG + Intergenic
1005621559 6:27625231-27625253 AGAGTCTCTGGGAGTGATTTTGG - Intergenic
1006336633 6:33424470-33424492 TCAGGGAATGGGGGTGATTTGGG + Intronic
1010930091 6:81791184-81791206 TGAGGCAGTGGGAATGGTGTTGG - Intergenic
1011280253 6:85670355-85670377 TGAGACATTGGGAGTGGGTTTGG - Intergenic
1011665877 6:89632947-89632969 TGAGGTAATAGGAGATATTTTGG - Exonic
1012609525 6:101199129-101199151 TGATGTATTGGGAGTGCTTTGGG + Intergenic
1015367360 6:132411510-132411532 TGAGGCCATGGGACTGATGCAGG - Intergenic
1015717067 6:136203903-136203925 TGAGGCAAGGGGAGGAATCTGGG + Intergenic
1016469912 6:144364364-144364386 AGAGGTAAAAGGAGTGATTTGGG + Intronic
1017589018 6:155958788-155958810 TGAGGCAATCAGAGAGCTTTAGG - Intergenic
1018095384 6:160383091-160383113 TGAGGGAATGGCAGTGAATTAGG + Intronic
1020331763 7:7025376-7025398 TGAGGCAGAGGGAGGGATGTTGG - Intergenic
1023743126 7:43298673-43298695 TGAGACAATGAAAGTAATTTGGG - Intronic
1024668627 7:51569833-51569855 TGAGGCAATAGCAGTGGTTCAGG + Intergenic
1027457650 7:78413610-78413632 TGAGGCAATGGGAGTGAATGAGG + Intronic
1029561189 7:101303667-101303689 TGGGGCAGTGGGTGTGATGTGGG - Intergenic
1029603255 7:101582458-101582480 GGGGTCACTGGGAGTGATTTGGG - Intergenic
1030587415 7:111437392-111437414 TGGGGCAATGGGCGTGATCTCGG - Intronic
1032456126 7:132074807-132074829 AGAGGCAAGGGGAGAGATATAGG + Intergenic
1032468618 7:132162371-132162393 TGAGGAAATTGGAGTGGTTCAGG - Intronic
1032878125 7:136059528-136059550 TGAATCAATAGGAGTGAATTTGG + Intergenic
1032901192 7:136310480-136310502 TGAGGCAATGGTGGGCATTTGGG + Intergenic
1033994705 7:147331148-147331170 TAAGGCAATGGCAGTGATCATGG + Intronic
1034198417 7:149265409-149265431 TGAGACAATGACAGTGATTATGG - Intronic
1035263593 7:157676502-157676524 TGAGGCACTGTGGGAGATTTGGG - Intronic
1036252295 8:7172860-7172882 TGAGGCAAGAGGAGTGCTTGAGG - Intergenic
1036365198 8:8114600-8114622 TGAGGCAAGAGGAGTGCTTGAGG + Intergenic
1039917411 8:41870462-41870484 TGAGGCTCAGGGAGTGCTTTAGG - Intronic
1040393233 8:46967855-46967877 TGAGGCAAAGTGAGTAATTTAGG - Intergenic
1042502191 8:69521686-69521708 GGAGGCCATGGGAAGGATTTTGG + Intronic
1043967997 8:86500875-86500897 TGCAGCAATGGATGTGATTTGGG - Intronic
1045762285 8:105624438-105624460 TGAGGCTGTGGGAGTGAAGTTGG + Intronic
1045985853 8:108249020-108249042 TGAGGCAATGTGACTGCATTGGG + Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1048272698 8:133042171-133042193 TGAGTCAATAAGATTGATTTTGG - Intronic
1049025385 8:139984712-139984734 TGAGGCACTGAGAGAGGTTTGGG + Intronic
1049909337 9:250331-250353 TGAGTCAAAGGGGGTGGTTTTGG + Intronic
1051220100 9:14839169-14839191 TGAAGCAATGGCAGTGAGGTGGG + Intronic
1051919003 9:22241820-22241842 TGAGGAAGTGGGAGAGACTTAGG - Intergenic
1052938102 9:34110317-34110339 TGAGGGAAAAGGAGTAATTTAGG - Intronic
1054805036 9:69389423-69389445 TGAGGGACTGGGAGAGAGTTTGG - Intronic
1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG + Intergenic
1058192366 9:101934240-101934262 TGTGGAAATAGGAGTGGTTTGGG + Intergenic
1185637529 X:1563957-1563979 TGAGGCAGAGGAAGTGATTGTGG - Intergenic
1186710883 X:12195250-12195272 TGAGACAATGGGACTGTTTTGGG + Intronic
1188716653 X:33466670-33466692 TGTGGTTATGGGAGTAATTTGGG + Intergenic
1188779154 X:34258804-34258826 TGTGGCAATGTGGGTCATTTAGG - Intergenic
1189361334 X:40354926-40354948 TGACGCACTGGGAGAGATGTGGG - Intergenic
1195252012 X:103058162-103058184 TGGGGCAATGGAAGTGCTTCAGG - Intergenic
1195343483 X:103926580-103926602 AGAGCTAATGGGAGTGATTCTGG + Intronic
1195363485 X:104106739-104106761 AGAGCTGATGGGAGTGATTTTGG - Intronic
1195522549 X:105848289-105848311 TGAGTGAGTGGGAGTGAGTTAGG - Intronic
1195578525 X:106476481-106476503 TGAGCCAATATGAGTGATTGCGG - Intergenic
1195920729 X:109981029-109981051 CGAGGCTATGGGAGAGATTTGGG + Intergenic
1196190024 X:112784487-112784509 TGAGGCAAAGGGATTGCTTAAGG + Intronic
1201367696 Y:13226625-13226647 TCAGGCTTTGGGAGAGATTTAGG - Intergenic
1201748286 Y:17404467-17404489 TTAGGCAAGGAGAGTAATTTTGG - Intergenic
1202582034 Y:26392265-26392287 TGAGGCCATGGGAGTGGGTAAGG + Intergenic