ID: 1118872145

View in Genome Browser
Species Human (GRCh38)
Location 14:69752407-69752429
Sequence CCCTTTGTTTGGGGCCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118872137_1118872145 -2 Left 1118872137 14:69752386-69752408 CCACCCAATATTTCCAATTGTCC 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1118872145 14:69752407-69752429 CCCTTTGTTTGGGGCCTCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 283
1118872139_1118872145 -6 Left 1118872139 14:69752390-69752412 CCAATATTTCCAATTGTCCCTTT 0: 1
1: 1
2: 6
3: 59
4: 384
Right 1118872145 14:69752407-69752429 CCCTTTGTTTGGGGCCTCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 283
1118872138_1118872145 -5 Left 1118872138 14:69752389-69752411 CCCAATATTTCCAATTGTCCCTT 0: 1
1: 0
2: 6
3: 71
4: 544
Right 1118872145 14:69752407-69752429 CCCTTTGTTTGGGGCCTCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118872145 Original CRISPR CCCTTTGTTTGGGGCCTCTG AGG Intronic
900369039 1:2323384-2323406 CCCTTCGTCTGGTGTCTCTGGGG - Intronic
900898278 1:5498872-5498894 TCCTTGTTTTGGGGGCTCTGGGG - Intergenic
901167794 1:7232153-7232175 CCCTTTGTCTCTGGCCTGTGTGG + Intronic
901194191 1:7431387-7431409 CCCTTTGACTGGGTCCTCTGGGG - Intronic
902213191 1:14918291-14918313 CTCTTTCTTGGAGGCCTCTGTGG + Intronic
903222459 1:21876387-21876409 CCAGTTGCATGGGGCCTCTGAGG - Exonic
903364322 1:22796561-22796583 CCCTTTGTTTGGGGGATGGGGGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904460246 1:30672813-30672835 CTCTTTGTTTTTGGCCTCTTTGG - Intergenic
905742516 1:40384642-40384664 TCCTTTATCTGTGGCCTCTGTGG - Intronic
906411863 1:45584780-45584802 TCCATTGTTTGGGGCCGCTGCGG + Intronic
906675196 1:47688327-47688349 CCCTTTGGCTCGGGGCTCTGAGG - Intergenic
908189258 1:61684491-61684513 CCCTTTGTTTGGCACTTCAGAGG - Intronic
908529511 1:65020995-65021017 CCCTTTGTATGCGGTCACTGTGG - Intergenic
909679219 1:78272922-78272944 CCATTTGTTTGTGTCATCTGTGG + Intergenic
912524665 1:110272442-110272464 CTCTTTCTCTGGGGCCTCTATGG - Intronic
913528883 1:119719027-119719049 CCTTTTCTTTGGAGCCTGTGTGG + Intronic
915507686 1:156367895-156367917 CCCTATCCCTGGGGCCTCTGCGG + Intergenic
915990997 1:160516347-160516369 CCATTTGTTTGTGTCCTCTCTGG - Intronic
917091971 1:171361812-171361834 CCCTTTATTTTGAGCCTATGTGG - Intergenic
920455365 1:206097143-206097165 CCATTTGTCTGAGGACTCTGAGG + Intronic
921903315 1:220470557-220470579 CCCCTTGTTTGGGATCTCAGAGG + Intergenic
922059280 1:222072210-222072232 CACTTTTTTTGGGGGGTCTGGGG - Intergenic
922531172 1:226346461-226346483 ACCTTTCTTTGGGGTCTCAGGGG - Intergenic
922718892 1:227890364-227890386 ACCATTGTTTGCTGCCTCTGTGG - Intergenic
922822736 1:228495114-228495136 CCCTTTCCTTGGGGCCTGGGGGG + Exonic
923673831 1:236064216-236064238 CTCCTCGTTTGGGGCCTCCGTGG + Intronic
924542163 1:244991360-244991382 CCCTTTGTTTAGGGTTTTTGTGG + Intronic
1062960395 10:1568881-1568903 CCATTTGTCTTGAGCCTCTGTGG + Intronic
1063226286 10:4017966-4017988 CCCTTTCTGTGTGGGCTCTGAGG - Intergenic
1063362338 10:5468818-5468840 TCCTCTGTTTTGGGCCTCAGGGG - Intergenic
1063998883 10:11646427-11646449 TGCTTTGTTTGGGGCCCCAGAGG + Intergenic
1069232582 10:66030064-66030086 CCATTTGTTTGTGTCATCTGTGG - Intronic
1069587394 10:69617335-69617357 CACTTTGTTCTGGGCCTCTGGGG + Intergenic
1069868008 10:71515954-71515976 CTATTTGTTTGGGGCCTTAGAGG + Intronic
1070064307 10:73018492-73018514 CCTGTTGTTTGGGCCCTGTGGGG - Intronic
1072171261 10:92864417-92864439 TTCTTTGTTTGGGGTCTGTGAGG + Intronic
1073556779 10:104461118-104461140 CCATTTGTTTGTGTCCTCTTTGG + Intergenic
1075178701 10:120189759-120189781 CCCTTTGTTTAGGACCTGAGAGG + Intergenic
1077488694 11:2850678-2850700 CCCTTTCTTCGGGCCCTTTGTGG + Intergenic
1077579055 11:3405147-3405169 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1077734535 11:4775274-4775296 CCATTTGTTTGTGTCCTCTCTGG + Intronic
1078072707 11:8128178-8128200 CACTTTGTGTGAGGCTTCTGGGG + Intronic
1079542854 11:21596628-21596650 CCATTTGTTTGTGTCATCTGTGG - Intergenic
1084089870 11:66872240-66872262 GCCTTTCTGTGGGGCCACTGTGG - Intronic
1084236077 11:67788666-67788688 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1084948734 11:72653122-72653144 GCCATTGTTTGGGGCTTCCGAGG + Intronic
1085599905 11:77846144-77846166 TTCTTTGTTTGTGGCTTCTGAGG + Intronic
1088879670 11:113963598-113963620 CCATGTGCTTGGGGCCTCAGAGG - Intergenic
1088888881 11:114029461-114029483 CCGTTGGATTGGAGCCTCTGGGG + Intergenic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1089692143 11:120193493-120193515 CCCACTGTATGGGGCCTGTGCGG + Intergenic
1090420874 11:126574032-126574054 CCCCTTGTCTGGGGCCTGTAAGG - Intronic
1090567228 11:128007457-128007479 ACCTTTGAATGGGGCTTCTGTGG - Intergenic
1091283168 11:134393863-134393885 CCCTCTCTTTGGGGGCACTGGGG - Intronic
1091724211 12:2834447-2834469 CCCATGGTTTGGTGGCTCTGAGG - Intronic
1092325174 12:7523533-7523555 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
1092406103 12:8223167-8223189 CTCCACGTTTGGGGCCTCTGAGG + Intronic
1092406986 12:8228030-8228052 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1095675237 12:44909430-44909452 CCATTTGTTTGTGTCATCTGTGG - Intronic
1096657107 12:53098568-53098590 CCCTGGATTTGGGGCCTCTTCGG - Intronic
1096811614 12:54173865-54173887 CTCTGTGTTTGGGGCATCTTCGG - Intronic
1096938190 12:55307574-55307596 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
1098101884 12:67026757-67026779 CCATTTTTCTGGGGCTTCTGAGG - Intergenic
1098721655 12:73907270-73907292 CACATTATTTGGGGACTCTGAGG - Intergenic
1100626834 12:96343492-96343514 GCCTTTATTTAGGCCCTCTGGGG + Intronic
1100980816 12:100160987-100161009 CCCTATGATTTGGGCCTATGGGG - Intergenic
1101454522 12:104816400-104816422 CCCTTTGTTTTGGGCCTCCAAGG - Intronic
1101774517 12:107781493-107781515 CCTTTTGTCTGTGGCTTCTGGGG + Intergenic
1101903997 12:108812036-108812058 CCGTGTGAATGGGGCCTCTGGGG + Intronic
1103251515 12:119504011-119504033 CTCTTTCTCTGGGGCATCTGAGG + Intronic
1106670613 13:31900598-31900620 CCCTTTGTTAAAGGCCTCTAAGG - Intergenic
1107315895 13:39131550-39131572 CCCTTTTTCTAAGGCCTCTGAGG - Intergenic
1107799581 13:44092395-44092417 CACTTTGTTTTTGACCTCTGTGG + Intergenic
1108111209 13:47074947-47074969 CCCTTTACTTAGGGCCTATGAGG - Intergenic
1113604731 13:111597240-111597262 CCCTTTGTTGGCCGTCTCTGGGG + Intronic
1116671696 14:47850453-47850475 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
1118872145 14:69752407-69752429 CCCTTTGTTTGGGGCCTCTGAGG + Intronic
1119508523 14:75193150-75193172 GCCCTAGTATGGGGCCTCTGTGG - Intergenic
1119551154 14:75514995-75515017 CCCTCTGCGTGGGGCCCCTGGGG + Intergenic
1120630633 14:86885866-86885888 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
1121258851 14:92552064-92552086 CCCTTTGTAGGGGGTGTCTGGGG + Intronic
1122295505 14:100703537-100703559 CTCCTTGTTTGGGGCCTTGGCGG - Intergenic
1123979380 15:25585917-25585939 CCATTTGTTTGTGTCATCTGTGG + Intergenic
1124570940 15:30863309-30863331 CCCTTTGCTAGAGCCCTCTGTGG + Intergenic
1126227300 15:46285785-46285807 CCATTTGTTTGTGTCATCTGTGG + Intergenic
1127772687 15:62243913-62243935 CCCTTCCCTTGGGGCCTCAGAGG + Intergenic
1128261876 15:66238269-66238291 GCCTTTCTCTGGGGCATCTGTGG - Intronic
1128742795 15:70095689-70095711 CCCTTGGGTCGGGGCCTCAGAGG - Intronic
1129198053 15:73982748-73982770 CCCCTTCTCTGGGGCCCCTGGGG + Exonic
1129951313 15:79594050-79594072 CCCTTTCTATGCTGCCTCTGGGG - Intergenic
1133611542 16:7438343-7438365 TCCATGGTTTGGGTCCTCTGGGG + Intronic
1134292625 16:12914734-12914756 CCCCATGCTTGGGGCCTGTGTGG + Intronic
1138832168 16:60387684-60387706 CCATTTGTTTGTTTCCTCTGTGG + Intergenic
1139395001 16:66632091-66632113 CCCTTTCTTAGTGGGCTCTGTGG - Intronic
1139901873 16:70334420-70334442 ACATTTGTTTGGGGCTACTGTGG - Exonic
1140054238 16:71511510-71511532 CCCTTTGTTTGGTGCCCCAGAGG + Intronic
1141848341 16:86626573-86626595 GCCTGTGTCTGGGGCTTCTGGGG - Intergenic
1142408705 16:89905208-89905230 CCCTTGCTGTGGGGCCTGTGTGG + Intronic
1142627327 17:1200657-1200679 CACTTTATTCGGGGCCTCCGTGG + Intronic
1143489802 17:7279628-7279650 CACTTTGTTTCCGGCTTCTGGGG - Intergenic
1143697497 17:8630959-8630981 CCATGAGATTGGGGCCTCTGTGG - Intergenic
1143782876 17:9238568-9238590 CCCTTTGGTTGGTGCATCTCAGG - Intronic
1143871216 17:9958582-9958604 CCCTGTGTTTGGGGCAGCTGGGG - Intronic
1145077322 17:19867165-19867187 CCGTTTGTTTTGGTCCTGTGAGG - Intronic
1146237122 17:31177152-31177174 CCGTTTGTTTGTGTCCTCTCTGG + Intronic
1146692262 17:34884523-34884545 CAGTTTGTTTGGGGCCTCCAGGG - Intergenic
1149833709 17:59893485-59893507 CCCTAGGTGTGAGGCCTCTGCGG + Intronic
1150287075 17:63960579-63960601 CCCTTTGTCAGGCTCCTCTGGGG + Intronic
1151392661 17:73798009-73798031 CCTTTGATTTGGGGACTCTGGGG + Intergenic
1151722699 17:75866746-75866768 CCGTTTGTGTGGTGCCTGTGAGG + Intergenic
1152147981 17:78580694-78580716 CCCTGTGTCTGGGAGCTCTGGGG - Intergenic
1152360396 17:79830726-79830748 CCCTTTGCTTGTGGGCACTGAGG + Intergenic
1152568967 17:81113105-81113127 GCCTTGCTTAGGGGCCTCTGAGG + Intronic
1203160740 17_GL000205v2_random:46707-46729 CCCTTTATTTTGAGCCTATGTGG - Intergenic
1153424141 18:4944559-4944581 CCCTTTCCTGGGGGCCTGTGAGG - Intergenic
1153515313 18:5895871-5895893 GCCTCTCTTTGGGGCCTCTGGGG - Exonic
1154100533 18:11468895-11468917 CACTTTGTGTGGGGCCTAGGAGG - Intergenic
1155758400 18:29531958-29531980 CCATTTGTTTGTGTCATCTGTGG - Intergenic
1156884927 18:42123997-42124019 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
1159225248 18:65525056-65525078 CCATTTGTTTGTGACCTCTCTGG - Intergenic
1160032979 18:75278566-75278588 GCCCTTGTTGGGGGCCTGTGGGG + Intronic
1160798037 19:954738-954760 CCCTTCGTCTGGGTCCCCTGTGG - Intronic
1161441850 19:4296450-4296472 CCCTTCTTTTGCAGCCTCTGAGG + Intronic
1161988134 19:7669046-7669068 CTCTTTCTTTGAGGCCTCTTGGG - Exonic
1162100868 19:8337891-8337913 CCCTCTGGCTGGAGCCTCTGGGG + Intronic
1162475963 19:10899473-10899495 CACTTTATCTTGGGCCTCTGTGG + Intronic
1162957525 19:14107526-14107548 ACCTTTTTCTGGTGCCTCTGGGG + Intronic
1163842798 19:19621553-19621575 CCCTTTCCTAGGGGCCTCTCTGG + Intergenic
1164125341 19:22309854-22309876 CCATTTGTTTGTGTCATCTGTGG + Intronic
1166376175 19:42328369-42328391 GTCTTTGTCTGGGGGCTCTGGGG + Intronic
1166679858 19:44759547-44759569 CCCTTTGCTGGGGTCCTCCGAGG + Exonic
1167826085 19:51974646-51974668 ACCTTTGTTTGGAGCCCCAGCGG + Intronic
1168254824 19:55159567-55159589 CCCTGAGCTTGGGGCCTGTGTGG - Exonic
926843639 2:17109334-17109356 CCCATTCTTTGGGAGCTCTGGGG + Intergenic
927645817 2:24876238-24876260 CCCATTGTTTTGGGCAACTGAGG - Intronic
928270344 2:29849750-29849772 CCCTTAGCTTAGGCCCTCTGAGG + Intronic
931509944 2:62980455-62980477 ACCTTTGTTTTGGCCCTCTTAGG - Intronic
931535854 2:63275728-63275750 CCATTTGTTTGTGTCCTCTTTGG - Intronic
931802743 2:65774427-65774449 CCCTTTTTTTGGAGGCTCTAGGG + Intergenic
931894305 2:66712212-66712234 CCCTTTGTACTGGACCTCTGGGG + Intergenic
932083966 2:68740841-68740863 CCCTTTCTTTGGGCAATCTGAGG - Intronic
932594066 2:73083387-73083409 CCCTGGGTTTGGGACCTGTGAGG - Intronic
934533746 2:95114838-95114860 CCCCTTGTTTGGGGCACCTGAGG - Intronic
935136981 2:100314560-100314582 CACTTTTTTGGGGGCCTCTGAGG + Intronic
935705243 2:105851094-105851116 CACTTGTTTTGGGGTCTCTGAGG + Intronic
936345424 2:111671938-111671960 TCCTTTGTAGGAGGCCTCTGTGG + Intergenic
936632138 2:114215094-114215116 CCCTTTGTTAGGAGCATCTGGGG - Intergenic
937075605 2:119103951-119103973 AACATTGTTTGGGGCCTTTGTGG + Intergenic
939505801 2:143045479-143045501 CCATTTGTTTGTGTCCTCTCTGG + Exonic
944116001 2:196186784-196186806 CCCTCTGTTGGAGGTCTCTGTGG - Intergenic
944595160 2:201254555-201254577 CCCTTTGTTTGTTGCCAATGTGG - Intronic
946023440 2:216657425-216657447 CCTTTTGTTTCTGACCTCTGGGG + Intronic
946024712 2:216664867-216664889 CCCTTTCTTTGGGGGCTGAGTGG - Intergenic
948933046 2:241144534-241144556 CCCTTTGGCTGGGAACTCTGGGG - Intronic
1169680812 20:8211146-8211168 CCCTTTGTTTGGTGCCCCAGAGG + Intronic
1170644608 20:18186248-18186270 ACCTATGTTTGGGCCCTCAGGGG - Intronic
1171936742 20:31281650-31281672 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
1172490347 20:35331585-35331607 CCCTTATTTTGGAGCCTTTGAGG - Intronic
1175143811 20:56881077-56881099 CCCTTGGTTTGGGGCCTCTTCGG - Intergenic
1175143830 20:56881131-56881153 CCCCTGGTTTGGGGCCTCCCTGG - Intergenic
1177845314 21:26281948-26281970 CCCTTTGTTTAGTGGCTCTGAGG + Intergenic
1181540377 22:23569845-23569867 CCCTTGGTCTGGGGCCTGGGTGG - Intergenic
1183402198 22:37611116-37611138 GCCTTTGTTTGGGGACTCGGAGG + Intronic
1184019840 22:41813580-41813602 CCCTTGAAATGGGGCCTCTGTGG - Intronic
1184122569 22:42462067-42462089 CTCTTTGTTTCTGGCCCCTGGGG - Intergenic
949857757 3:8477612-8477634 CCCTTTGTGGGGGGCCTTTGTGG - Intergenic
952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG + Intergenic
955356636 3:58237671-58237693 CGCTCTGTTTGGGGGCTCCGGGG - Exonic
957052045 3:75418465-75418487 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
957422693 3:79991900-79991922 CACTCTGTTTGGGGCCTCTCGGG - Intergenic
959559035 3:107758517-107758539 GCCTTTGCTCGGGACCTCTGAGG + Intronic
961087092 3:124077375-124077397 CCCCTGGTTTGGGGCTCCTGAGG + Intergenic
961402243 3:126655533-126655555 CCCTTTGTTAGGGGCGGCTCTGG - Intergenic
961885654 3:130094697-130094719 CCCTTGGTAAAGGGCCTCTGGGG - Intronic
962134532 3:132720848-132720870 CCCTCAGTTTGGGGCCCCTCTGG - Intronic
962536582 3:136334576-136334598 GCCTCAGTCTGGGGCCTCTGTGG + Intronic
963301805 3:143605928-143605950 CCCTTTGTTTCTTACCTCTGGGG - Intronic
963890969 3:150635626-150635648 CTCTTTCTTTGTGTCCTCTGGGG - Intergenic
963906018 3:150774236-150774258 CACCTTCTTTGGGGGCTCTGTGG - Intergenic
964452511 3:156825983-156826005 CCCTTGCTCTGGGGCCTATGTGG - Intronic
964673708 3:159254854-159254876 TCCTATGTTTTGGGACTCTGAGG + Intronic
965159638 3:165115796-165115818 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
966744941 3:183266538-183266560 CCCTTGTTTTGGGGCTTCAGAGG + Intronic
967134567 3:186502561-186502583 CCCATTGTTTCTGGCCACTGTGG - Intergenic
968230083 3:197000397-197000419 TCCTTTTTCTGGGGCCTCGGTGG + Intronic
968994846 4:3938840-3938862 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
969369340 4:6721274-6721296 CCCTTTGCTTGGGACCCCAGAGG - Intergenic
969544140 4:7812929-7812951 CCTTCTGTTTGGGGGCTGTGAGG - Intronic
969760022 4:9174816-9174838 CTCCATGTTTGTGGCCTCTGAGG - Intronic
971080696 4:23207524-23207546 CCATTTGTTTGCGTCATCTGTGG + Intergenic
973562883 4:52153730-52153752 CCCTTTATTTTGAGCCTATGTGG - Intergenic
974710802 4:65592270-65592292 CCCTTTGTTTCTGCCCTGTGTGG - Intronic
975889579 4:79011200-79011222 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
978460826 4:108950134-108950156 CCCTTTGCTTAGGGCCTCAGAGG + Intronic
980021725 4:127718631-127718653 CCATTTGTTTGTGTCCTCTCTGG + Exonic
983230396 4:165124392-165124414 CACTTTGTCTGGGGTCCCTGAGG - Intronic
985988664 5:3537882-3537904 CGCTTTGGCTGGGGACTCTGAGG + Intergenic
986206530 5:5629931-5629953 GCATTTGTTGGGTGCCTCTGGGG - Intergenic
990040061 5:51369093-51369115 CGCTTTGTTTGGGTGATCTGGGG - Intergenic
990277907 5:54218548-54218570 CACTTTATTTGGGGTCACTGTGG + Intronic
991941691 5:71859499-71859521 CCCTTTGCTTTGTGCCTCCGTGG + Intergenic
992019081 5:72604760-72604782 CCCGTTGGCAGGGGCCTCTGGGG - Intergenic
993020024 5:82580867-82580889 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
993754838 5:91715744-91715766 CCATTTGTTTGTGTCATCTGTGG + Intergenic
995859194 5:116623912-116623934 CTCTGGGATTGGGGCCTCTGAGG + Intergenic
996027536 5:118664983-118665005 CCATTTGTTTGTGTCCTCTATGG - Intergenic
997796515 5:136816434-136816456 CCCTTTCTTTGAGGCCCCAGAGG - Intergenic
998352141 5:141508744-141508766 CTCTTTCTCTGGCGCCTCTGAGG + Intronic
999871382 5:155754958-155754980 CCATTTCTTTGGGTCCTCTCTGG - Intergenic
1000904124 5:166942597-166942619 CCCTTGGGTTTGGGACTCTGAGG + Intergenic
1001070299 5:168579538-168579560 CCTTTTGTTTGGAGCGGCTGCGG - Exonic
1001754390 5:174157224-174157246 TCCTCTGCTTTGGGCCTCTGTGG + Intronic
1004660783 6:17707106-17707128 CCCTTGGCTTTGTGCCTCTGCGG - Intergenic
1005317403 6:24617490-24617512 CTCTTTGTTTTGGGCCTTTGGGG - Intronic
1005329248 6:24733148-24733170 CTCTTTGTTTTGGGCCTTTGGGG - Intergenic
1012435660 6:99212489-99212511 CCATTTGTTTGTGTCATCTGTGG - Intergenic
1012465166 6:99509517-99509539 GCTTTTGATTTGGGCCTCTGAGG - Intronic
1012549354 6:100453478-100453500 CCCTTGGTTAGGGGCCTCGTTGG + Intronic
1012762125 6:103315913-103315935 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
1013010746 6:106117875-106117897 CCCTTTGGATGGTGCCTATGGGG + Intergenic
1014881433 6:126728514-126728536 CCCTTTATTTTGGGCCTATATGG - Intergenic
1018843137 6:167532996-167533018 CCCTTTATTCCTGGCCTCTGTGG - Intergenic
1019493587 7:1326039-1326061 CTCTTTGGACGGGGCCTCTGGGG + Intergenic
1020319107 7:6927163-6927185 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1021840623 7:24718976-24718998 ACCTTGGTTGGGGGCCTCTTTGG - Intronic
1023304613 7:38812270-38812292 CCCATTGTGTGGGCCCTTTGTGG - Intronic
1026240722 7:68572681-68572703 CCCTTTGTGTTTAGCCTCTGAGG + Intergenic
1026887817 7:73964753-73964775 CCCTCTGATTGGGGCTTCTCAGG - Intergenic
1030071967 7:105705658-105705680 CCTTTTGTTTCACGCCTCTGTGG + Intronic
1030091608 7:105863278-105863300 CCCCAGCTTTGGGGCCTCTGTGG - Intronic
1032515875 7:132505888-132505910 CCCTTTGTTTGGGGCAGTAGTGG - Intronic
1033248689 7:139740152-139740174 CGCTTTGCCTGGGACCTCTGGGG - Intronic
1034957970 7:155346485-155346507 CCCTCTGTGTGGGGGCTCTATGG - Intergenic
1036263639 8:7258547-7258569 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036264940 8:7266169-7266191 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036266241 8:7273791-7273813 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036267542 8:7281413-7281435 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036268844 8:7289035-7289057 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036297747 8:7550398-7550420 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036299051 8:7558046-7558068 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036300356 8:7565696-7565718 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036301661 8:7573340-7573362 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036302958 8:7580989-7581011 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036315680 8:7717086-7717108 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036316989 8:7724734-7724756 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036318296 8:7732382-7732404 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036319605 8:7740029-7740051 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036320912 8:7747677-7747699 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036322222 8:7755325-7755347 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036323531 8:7762973-7762995 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036324825 8:7770620-7770642 CTCCACGTTTGGGGCCTCTGAGG - Intergenic
1036351209 8:8013687-8013709 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036352515 8:8021333-8021355 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036353807 8:8028981-8029003 CTCCACGTTTGGGGCCTCTGAGG + Intergenic
1036381304 8:8237985-8238007 CCCTTGGTAAAGGGCCTCTGGGG + Intergenic
1036846482 8:12174106-12174128 CTCCATGTTTGGGGCCTCTGAGG + Intergenic
1036847358 8:12179007-12179029 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1036867845 8:12416425-12416447 CTCCATGTTTGGGGCCTCTGAGG + Intergenic
1036868723 8:12421328-12421350 CCCTTGGTAAAGGGCCTCTGGGG - Intergenic
1037476071 8:19259067-19259089 CCTCTTGTTTTAGGCCTCTGTGG - Intergenic
1039799268 8:40940184-40940206 CCATTTGTTTGGTGACTGTGAGG - Intergenic
1040566494 8:48572276-48572298 CCTTGTGTTTGAGGCCACTGTGG + Intergenic
1040931433 8:52739070-52739092 CCATTGGTTTGGGGCCATTGGGG + Intronic
1041295657 8:56355061-56355083 CCCTTTATTTTGAGCCTATGTGG + Intergenic
1044264414 8:90165525-90165547 TCCTTTGTGTGGGGCCTCAAAGG + Intergenic
1044450543 8:92331154-92331176 CCATTTGTTTGTGTCCTCTCTGG + Intergenic
1044481173 8:92690395-92690417 CCCTTGGTTTCAGGCCCCTGGGG - Intergenic
1045143326 8:99312041-99312063 CCCTTTATTTTGAGCCTATGTGG + Intronic
1048046878 8:130780960-130780982 CACTATGTGTGGGGTCTCTGTGG + Intronic
1050276546 9:4007211-4007233 CCCTATTTTAGGGGCTTCTGAGG - Intronic
1050564983 9:6872738-6872760 CCCTTTATTTTGAGCCTGTGTGG + Intronic
1051213075 9:14765975-14765997 AACTTAGTTTGGGGCTTCTGCGG + Intronic
1052885444 9:33643182-33643204 CCATTTGTTTGGGTCCTCTCTGG - Intergenic
1053010114 9:34628125-34628147 CCCTGTGTTGGGGGGCTCTGGGG - Intergenic
1055187754 9:73475688-73475710 CCCCTTCTTGTGGGCCTCTGTGG + Intergenic
1056529086 9:87471095-87471117 ACATCTGTTTGGGGCCTCTAGGG - Intergenic
1056578589 9:87873811-87873833 CCCTTATTTTGGGGCACCTGGGG - Intergenic
1056840882 9:89997217-89997239 CCCTTTGTTTGGGGATTTTGTGG + Intergenic
1057918548 9:99076562-99076584 CCCTTTGGTTGGAAACTCTGAGG - Intergenic
1058632044 9:106999161-106999183 CCCTTTGTTGTGGGCCTTTGGGG + Intronic
1059124035 9:111666802-111666824 CCCTTTGTTTCAGGTCTCTCAGG + Exonic
1059595919 9:115720651-115720673 TCCTTTGTGAGGTGCCTCTGGGG + Intergenic
1060011906 9:120051049-120051071 ACCTTAATTTGTGGCCTCTGGGG + Intergenic
1060224752 9:121784002-121784024 CCCTTCAGGTGGGGCCTCTGTGG - Exonic
1060585101 9:124780696-124780718 CCCTTTGGCTGGGGCATCTGGGG + Intronic
1060997937 9:127885630-127885652 CCCTTTGTCTGGAGTCACTGGGG - Exonic
1061062624 9:128258269-128258291 CCCTTCCCTTGGGGCCTCAGAGG + Intronic
1061215495 9:129219382-129219404 CCGCATGTTTGTGGCCTCTGGGG + Intergenic
1061654287 9:132076743-132076765 CCTTTTGTTTGGGTGCTATGTGG - Intronic
1062052180 9:134453306-134453328 CCCTCTGGGTGGGGGCTCTGTGG + Intergenic
1062327680 9:136019958-136019980 CCCTCTGTTTCCCGCCTCTGTGG - Intronic
1062552910 9:137098285-137098307 CCGTTTGTTGGGGGCCTCCCAGG + Intronic
1188626587 X:32292555-32292577 CCCTTTGTTTTGGGAGGCTGAGG - Intronic
1190056667 X:47185247-47185269 TCCTTCCTTTGGGCCCTCTGTGG + Intronic
1190503357 X:51100856-51100878 CCATTTGTCTGGGGCATTTGAGG + Intergenic
1190972205 X:55361064-55361086 CCATTTGTTTGTGTCCTCTCTGG - Intergenic
1191022714 X:55879270-55879292 CACCTTGTTTGGGGCTTTTGGGG - Intergenic
1192826131 X:74697981-74698003 CCCTTTATTTTGCGCCTATGTGG - Intergenic
1194984668 X:100477634-100477656 CAATTTGTCTGGGGCCCCTGGGG - Intergenic
1195147691 X:102033699-102033721 CCCTTTATTTTGAGCCTATGTGG - Intergenic
1195704190 X:107726717-107726739 CTCTGTGGGTGGGGCCTCTGTGG + Intronic
1196763910 X:119225731-119225753 CCCTCTGTTATGGGCTTCTGGGG + Intergenic
1197323818 X:125067211-125067233 CCCTTTCTTTGGGGACTTTGAGG - Intergenic
1197356828 X:125445439-125445461 ACCTTTGGTTGGGGCTTTTGTGG - Intergenic
1197633628 X:128890435-128890457 CCCATTTATTGAGGCCTCTGTGG - Intergenic
1197712071 X:129678553-129678575 CCCCTTGTCTCGGGGCTCTGAGG - Intergenic
1198490173 X:137131716-137131738 CCCTTTATTTTGAGCCTATGTGG - Intergenic
1199699669 X:150365724-150365746 CCCTTTGTTTGGAGGCGCGGAGG + Intronic
1199879097 X:151958800-151958822 CCTTTTTCTTGGGGACTCTGGGG - Intronic
1202178511 Y:22119491-22119513 CCCTTTATTTTGGGCCTTTCAGG + Intergenic
1202212850 Y:22466903-22466925 CCCTTTATTTTGGGCCTTTCAGG - Intergenic