ID: 1118872158

View in Genome Browser
Species Human (GRCh38)
Location 14:69752503-69752525
Sequence CTGTTAAAAAGGAGATACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118872149_1118872158 17 Left 1118872149 14:69752463-69752485 CCTCTCAGTCATCTTGAATCTCT 0: 1
1: 0
2: 2
3: 16
4: 235
Right 1118872158 14:69752503-69752525 CTGTTAAAAAGGAGATACCTGGG 0: 1
1: 0
2: 2
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118872158 Original CRISPR CTGTTAAAAAGGAGATACCT GGG Intronic
903306006 1:22413786-22413808 TTGTCAAAGAGGAGATACCCAGG - Intergenic
906449294 1:45931114-45931136 CTGTTACAAAGGATATTACTGGG - Intronic
906787251 1:48626871-48626893 CTGTTAAAAATCACATCCCTAGG - Intronic
907359829 1:53905565-53905587 CTGTTAAAACGCAGATGTCTGGG + Intronic
907974877 1:59421925-59421947 GAGTTTTAAAGGAGATACCTGGG + Intronic
908553923 1:65237966-65237988 CTGTTAATAAAGACATACTTGGG + Intergenic
908861908 1:68498761-68498783 CTGTTAAAATGCTGATTCCTGGG + Intergenic
911753852 1:101529969-101529991 CTGGGAAAAAGGATATATCTTGG + Intergenic
912182167 1:107232407-107232429 TTGTTAAAAGGGAGAAACCATGG - Intronic
912630957 1:111246496-111246518 CTCTTAAGAAGGAGGTATCTTGG + Intergenic
915677446 1:157544779-157544801 TTGGTCAAAAGGAGATTCCTTGG - Intronic
916842611 1:168615356-168615378 CTGTTGAAAGGGAGATCTCTGGG - Intergenic
918566168 1:185935375-185935397 CTGTTAAAATGCAGATTCCCAGG - Intronic
920009124 1:202855041-202855063 CTGGTAAAAAGGCGTTCCCTAGG - Intergenic
921485574 1:215712027-215712049 CTGTTAAAAACGAGACACCAAGG + Intronic
921562620 1:216676625-216676647 TTGTTAAAATGCAGATTCCTGGG - Intronic
1063806170 10:9644424-9644446 CTGTAAATAAGTAGAAACCTAGG - Intergenic
1064919805 10:20504111-20504133 CTGCTAATAAAGACATACCTGGG - Intergenic
1067407603 10:46037206-46037228 CTGTTAAAATTCAGATTCCTTGG + Intronic
1070296611 10:75166922-75166944 TTGTTAAAATGCAGATTCCTAGG + Intronic
1071938729 10:90562288-90562310 CTGTCAAAAAGTAGAAACATTGG - Intergenic
1072523760 10:96253645-96253667 TTGTTAAAAAGCAGATTGCTGGG - Intronic
1072631493 10:97149991-97150013 ATGGTAAAAAGGAGCTTCCTTGG - Intronic
1073017916 10:100416710-100416732 CTGCTAAAAAGGACATTCTTGGG - Intergenic
1073525662 10:104179861-104179883 ATGTTAAGAAGGAAATTCCTTGG - Exonic
1073687477 10:105771127-105771149 CTGTTAAAACAGAGATACTGAGG + Intergenic
1074068255 10:110038359-110038381 CTGTAAGGAAGGAGAGACCTTGG + Intronic
1074080824 10:110166857-110166879 CTATTCAAAAGCAGATTCCTGGG - Intergenic
1074206948 10:111290807-111290829 TTGTTAAAATGCAGATCCCTAGG - Intergenic
1076350001 10:129809119-129809141 ATGTTAGAAAGGAGATTACTAGG + Intergenic
1076672335 10:132130184-132130206 CTGTGAGAAAGCAGAGACCTGGG - Intronic
1078595497 11:12682869-12682891 ATGTTAAAAATGTGTTACCTTGG - Intronic
1078629307 11:12987705-12987727 CTGTTAAAAAGGAATTAACTTGG + Intergenic
1080173107 11:29329863-29329885 CTGTTAAAATGCAGATTGCTGGG + Intergenic
1080912906 11:36623132-36623154 TTATTAAAAAGTAGATTCCTAGG + Intronic
1082099291 11:48158644-48158666 TTGTTTAAAAAGAGATGCCTGGG - Intronic
1083168495 11:60906850-60906872 TTGTTAAAATGCAGATTCCTCGG + Intergenic
1083519197 11:63292067-63292089 CTGCTAATAAAGACATACCTGGG + Intronic
1084435363 11:69136324-69136346 CTGCTAATAAAGACATACCTGGG - Intergenic
1084781236 11:71410024-71410046 CTATGAAAAATGAAATACCTAGG - Intergenic
1087908733 11:103728156-103728178 CTGCTAATAATGACATACCTGGG + Intergenic
1088021560 11:105125710-105125732 CTGTGTAAAAGGAGATATTTTGG - Intergenic
1088162956 11:106895693-106895715 CTGCTAAGAAAGACATACCTGGG - Intronic
1088762912 11:112949226-112949248 CTGCTAATAAGGACATACCTGGG + Intergenic
1089174568 11:116539170-116539192 CTTTTAAAATGCAGATGCCTGGG - Intergenic
1089219609 11:116859751-116859773 TTGTTAAACAGAAGATTCCTGGG + Intronic
1089364403 11:117912195-117912217 CTGTTAAAATGGTGATCGCTGGG - Intronic
1090548652 11:127793890-127793912 TTGTTTTAAAGGAGATACCGAGG + Intergenic
1090707072 11:129347908-129347930 CTGTTAAAAAAGAAATACAATGG + Intergenic
1091026205 11:132143337-132143359 CTGATAAAAAAGAGATTCCTGGG - Intronic
1092329268 12:7567508-7567530 CTCTGAAGAAGGAGAGACCTAGG + Intergenic
1092526538 12:9313225-9313247 CTGTTACAAAGGTGAAACCCAGG + Intergenic
1092540737 12:9418557-9418579 CTGTTACAAAGGTGAAACCCAGG - Intergenic
1093505581 12:19862003-19862025 TTGTTAAAAAGTAGATATTTTGG - Intergenic
1094512311 12:31103927-31103949 CTGTTACAAAGGTGAAACCCAGG + Exonic
1094763135 12:33558429-33558451 TTTTAAAAAAGCAGATACCTGGG - Intergenic
1095279613 12:40334897-40334919 CTTTAAAGAAGGAGATACGTGGG + Intronic
1095588707 12:43878669-43878691 ATATTAAAAAGGAAAAACCTTGG + Intronic
1096221991 12:49835923-49835945 CTGTTAACAAGGAGTTATCTGGG + Intergenic
1096436664 12:51596766-51596788 CTTTTAAAAAGGTCATATCTTGG + Intronic
1096440783 12:51641957-51641979 CTGTTGAAAAGAAGATGCATTGG + Intronic
1096861542 12:54532293-54532315 TTGTTGAAAAGGAGGTAGCTAGG + Intronic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1098944527 12:76574740-76574762 CTGCTAATAAAGAAATACCTGGG + Intergenic
1098965057 12:76778961-76778983 CTTTTAAAAAGGAGAAAATTTGG - Intronic
1099514700 12:83583643-83583665 CTGTTAATAAGGAGTTAAATTGG - Intergenic
1100015029 12:89999281-89999303 CTGTTATAATGAAGATTCCTGGG - Intergenic
1100293993 12:93243828-93243850 CTGTTAAAATAGAGATGACTGGG - Intergenic
1101155865 12:101926924-101926946 CTGATAAAAAGTGGATACCTAGG - Intronic
1101194476 12:102368812-102368834 CTGTTAATAAAGACATACCCAGG + Intergenic
1101444707 12:104729500-104729522 TTGTTAAAATGCAGATTCCTGGG - Intronic
1102650409 12:114438272-114438294 CTGTTGAGAAGGGGAGACCTGGG + Intergenic
1102774941 12:115510378-115510400 CTGTTAACAGGAATATACCTAGG + Intergenic
1103222442 12:119257068-119257090 CTGCTAATAAAGACATACCTGGG - Intergenic
1104276591 12:127334075-127334097 CTGTTAGAAAGGAGATGTCCTGG - Intergenic
1104656942 12:130580538-130580560 CTGCTAATAAAGACATACCTGGG - Intronic
1105286977 13:19012383-19012405 CTGAAAAAAAGGAGAGCCCTGGG + Intergenic
1107075029 13:36314410-36314432 CTTTTAAAAAGGTGCTTCCTGGG - Exonic
1107574270 13:41700128-41700150 CTGTTGTAAAATAGATACCTGGG - Intronic
1107927941 13:45281582-45281604 TTGTTAAAATGCAGATTCCTGGG + Intronic
1108451443 13:50569970-50569992 CTGCTAAAAGGGAGAAATCTAGG - Intronic
1109162487 13:58992744-58992766 CTGTTAAAAAAGAGAAACCCAGG + Intergenic
1109496484 13:63178515-63178537 CTGTTCCAAATGAGATACATTGG - Intergenic
1109993795 13:70095014-70095036 CTGTAAAAAGAGAGATACCCAGG - Intronic
1110102724 13:71630039-71630061 ATTTTTAAAAGGAGAGACCTTGG + Intronic
1110406591 13:75157632-75157654 CTGTTAAAAATGAGACACACAGG - Intergenic
1110483375 13:76009947-76009969 CTCATAAAAAGGATAAACCTAGG - Intergenic
1112493480 13:99887214-99887236 TTGTTAAAATGCAGATTCCTGGG - Intronic
1112664495 13:101554075-101554097 CTTATAAAAAGGGGAAACCTCGG - Intronic
1114410378 14:22495124-22495146 CTGTTCTAAAGGAAATACATAGG - Intergenic
1115085426 14:29509322-29509344 TTGTTAAAATGTAGATATCTAGG + Intergenic
1115192259 14:30758213-30758235 CTGTTAAAAAAGAGCTAGTTTGG - Intergenic
1115537136 14:34383932-34383954 TTGTTAAAATGCAGATCCCTAGG + Intronic
1117899514 14:60517272-60517294 CTGCTATAAAGGAAATACTTTGG - Intergenic
1118696913 14:68394673-68394695 CTGGGATAAAGTAGATACCTTGG - Intronic
1118742194 14:68747681-68747703 CTCTTAAAAAAGAAATCCCTTGG + Intergenic
1118872158 14:69752503-69752525 CTGTTAAAAAGGAGATACCTGGG + Intronic
1119451397 14:74713994-74714016 CTTATAAAATGGAGATATCTTGG - Intronic
1119566041 14:75630195-75630217 CTGGTAGAAAGCAGATTCCTAGG - Intronic
1120432336 14:84435016-84435038 CTGCTCAAAAGGAGGTAACTTGG - Intergenic
1121819581 14:96955376-96955398 CTGTTAAAAACTAAAAACCTAGG + Intergenic
1121950539 14:98167458-98167480 CTGTTAGGAAGGGGAGACCTAGG + Intergenic
1202876567 14_KI270722v1_random:8222-8244 GTGTTAAAAAGAAAATACCTTGG + Intergenic
1125009943 15:34860825-34860847 CTGTTAAATTGCAGGTACCTAGG + Intronic
1125066702 15:35495755-35495777 CTCTTAAAAAGGAATTACATTGG + Intronic
1125185560 15:36925741-36925763 CTATAAAAAAGGAAATACTTTGG - Intronic
1127026752 15:54815305-54815327 CTGTTACAAAAGAGATAAATTGG - Intergenic
1127860386 15:62989102-62989124 CCGGTGAAAAGGAGACACCTAGG - Intergenic
1131363652 15:91818349-91818371 CTGCTAAAAAGGATAAAGCTGGG + Intergenic
1131462721 15:92630022-92630044 CTGCTAATAAAGACATACCTGGG - Intronic
1132110460 15:99098956-99098978 TTGTTAAAATGCAGATCCCTGGG - Intronic
1132287189 15:100671758-100671780 CTCTTAAAAAGGAAAAAACTGGG - Intergenic
1133875741 16:9732669-9732691 CTGTTAAAATGAAGATTTCTGGG - Intergenic
1133884872 16:9817379-9817401 CTGTCAAAATGCAGATTCCTGGG - Intronic
1135108518 16:19671899-19671921 TTGTTAAAATGCAGATTCCTGGG + Intronic
1135810398 16:25581529-25581551 CTGCTAATAAAGACATACCTGGG - Intergenic
1136088343 16:27901562-27901584 ATGTTAAAATGCAGATTCCTGGG + Intronic
1137018659 16:35400497-35400519 CTGCTGAAAAAGACATACCTAGG - Intergenic
1138376435 16:56567492-56567514 CTGTGAAAATGCAGATTCCTGGG - Intronic
1138541098 16:57688329-57688351 CTGTTAGGAAGGAGAGGCCTCGG - Intronic
1139730838 16:68943663-68943685 CTGTTAAAAAAAAAATATCTTGG - Intronic
1141076224 16:81008324-81008346 CCGTTAAAATGAAGATTCCTGGG - Intronic
1141349243 16:83277415-83277437 CTGTTAAAATGCAGATTCCCTGG - Intronic
1141676699 16:85521560-85521582 CTGTAAAGAAGAAGATACCGAGG - Intergenic
1142013457 16:87729831-87729853 TTGTTAAAATGCAGATTCCTGGG + Intronic
1143569919 17:7750367-7750389 CTGTTACAAAGCAGTTACCCCGG + Intronic
1144168870 17:12639153-12639175 TTGTTTAGAAGGAGATACTTTGG - Intergenic
1145853372 17:28126331-28126353 CTTTAAAAAATCAGATACCTGGG - Intronic
1145856500 17:28163590-28163612 CTGTTCACAAGGAGATTCCCTGG - Exonic
1147038772 17:37701284-37701306 CTGTTACATAGGAGATTCCATGG + Intronic
1147385510 17:40079078-40079100 CTGTTAAAAGGAAGATTCCTGGG - Intronic
1147912210 17:43862438-43862460 CTGTGAAAAACGTGATTCCTGGG + Exonic
1148129966 17:45256693-45256715 TTGATAAAAATGAGATTCCTGGG - Intronic
1148787293 17:50151551-50151573 GTGTTAAAATGCAGATTCCTGGG - Intergenic
1150447492 17:65238511-65238533 CTGTTAAAATGGAGCTACAATGG - Intergenic
1151290069 17:73143361-73143383 CTGTTTAAATGCAGATTCCTAGG + Intergenic
1153237929 18:3006340-3006362 CTGTTAAAAATAACTTACCTAGG - Intronic
1153695350 18:7634737-7634759 CTGTGTAAAAGGTGATAACTAGG - Intronic
1155685044 18:28538290-28538312 CTGCTAATAAAGACATACCTGGG + Intergenic
1155873536 18:31056223-31056245 CTATTAAGAAACAGATACCTTGG - Intergenic
1156312606 18:35938636-35938658 CTGGTAAAAATGTGACACCTTGG - Intergenic
1156434094 18:37107594-37107616 CAGTGAAAAATGAAATACCTAGG - Intronic
1156772114 18:40741213-40741235 CTGTTAAAAAAGAGATAACTGGG - Intergenic
1157885752 18:51364685-51364707 CTGTTAAAAATGAGATTCCTGGG + Intergenic
1157948797 18:52011280-52011302 GTGTTAGAAAGGAGATTGCTAGG - Intergenic
1158046867 18:53166690-53166712 TTGTTAAAAAGGATAAATCTAGG - Intronic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1162436483 19:10663040-10663062 CTGTTCAAAATGAGAAACGTGGG - Intronic
1163593610 19:18208086-18208108 CTTTTAAAAAGAAGATATTTAGG - Exonic
1164359660 19:27490455-27490477 TGGTTAAAAAGGAAATATCTTGG + Intergenic
1168060274 19:53888027-53888049 CTGTTAAAAAGGAGACAGCACGG - Intronic
1202674095 1_KI270710v1_random:24597-24619 GGGTTAAAAAGAAAATACCTCGG - Intergenic
925387920 2:3475411-3475433 CTATTAAAAAGGAAATACAGTGG - Intronic
925717476 2:6797609-6797631 TTTTTAAAAATGAGAAACCTGGG + Intergenic
926848172 2:17165241-17165263 ATTTTAAAAAGGAGTAACCTTGG - Intergenic
927065541 2:19467231-19467253 CTGCTAAAGGGGAGATTCCTGGG - Intergenic
928226269 2:29450869-29450891 CTGTTAAAAAACAGATTCCTAGG + Intronic
928451612 2:31383135-31383157 CAGCTCCAAAGGAGATACCTGGG + Exonic
928944258 2:36758136-36758158 CTGTTAAAATTAAAATACCTTGG - Intronic
929174487 2:38962570-38962592 CAGTTCAAAATGAGATACCAAGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930157333 2:48118984-48119006 CTGTAAAAATGGAGACACCTTGG - Intergenic
930676440 2:54205661-54205683 TTGGTAAAAAGGAGATACTTGGG - Intronic
930744115 2:54863283-54863305 CTATTAGATAGCAGATACCTGGG - Intronic
930847276 2:55919338-55919360 TTGTTAAAATGAAGATTCCTGGG + Intronic
930925612 2:56815398-56815420 CTTTTAAAAAAGAGATATTTTGG + Intergenic
932282527 2:70506448-70506470 CTGTTGAAATGCAGATTCCTAGG - Intronic
932836433 2:75042367-75042389 TTGTTAAAATGCAGATTCCTTGG + Intergenic
934080649 2:88464970-88464992 TTGTTAAAATGCAGATTCCTTGG + Intergenic
935365287 2:102282941-102282963 CTGTGAAAATGGAGATGACTGGG + Intergenic
935765482 2:106362994-106363016 CTGTTAAAATGCAGATCCCTAGG - Intergenic
938835593 2:135100445-135100467 ATAATAAAAAGGAGATTCCTGGG - Intronic
939709824 2:145503597-145503619 CTGTTAAGAAGGAAATTGCTTGG - Intergenic
940306408 2:152232022-152232044 CTGCTAATAAAGACATACCTGGG - Intergenic
940464392 2:154009748-154009770 TTGTTAAAATGGTCATACCTTGG - Intronic
940765252 2:157783299-157783321 CTGTCAAAAACTAGAGACCTTGG - Intronic
940989378 2:160082633-160082655 CTGTTATAAAGATGATAACTAGG + Intergenic
941068029 2:160925146-160925168 CTTTTAAAATGCAGATTCCTGGG + Intergenic
941864231 2:170317347-170317369 TTGTTAAAATGCAGATTCCTGGG + Intronic
942935634 2:181553099-181553121 TTGCTAAAACAGAGATACCTGGG - Intronic
944444370 2:199774634-199774656 GTCTTAGAAAGGGGATACCTGGG - Intronic
945520943 2:210826478-210826500 CTGTTAAAATTCAGATCCCTGGG + Intergenic
948428617 2:237904037-237904059 CTCTTAAAAAGGAGAATGCTAGG - Intronic
1170210945 20:13845915-13845937 TTTTTAAAAAACAGATACCTTGG + Intergenic
1170363038 20:15568254-15568276 CTGGTAAAATGGAGATTGCTGGG + Intronic
1170839152 20:19909652-19909674 CTGTAAAAGATGAGATAACTTGG - Intronic
1170879342 20:20281352-20281374 CTGTTAAATATGAGATAATTTGG + Intronic
1171723271 20:28588325-28588347 CTGCTACAAAGAAGATACTTAGG + Intergenic
1171754783 20:29094757-29094779 CTGCTACAAAGAAGATACTTAGG - Intergenic
1171860072 20:30391604-30391626 CTGCTAAAAAGAAGATACTTAGG - Intronic
1172942498 20:38664088-38664110 CAGGTAAAAAGGAGATACCCTGG - Intergenic
1173045458 20:39505135-39505157 CTGCTAATAAAGACATACCTGGG - Intergenic
1173349187 20:42229192-42229214 TTGTTAAAAAGCAGATCCCCAGG + Intronic
1173417065 20:42866095-42866117 TTTTTAAAAAGCAGATTCCTGGG - Intronic
1174988084 20:55478428-55478450 CTGTTAAAAAGGACAGTTCTGGG - Intergenic
1176637833 21:9265664-9265686 GTGTTAAAAAGAAAATACCTCGG + Intergenic
1176659365 21:9619801-9619823 CTGCTAATAAAGACATACCTGGG + Intergenic
1177013739 21:15758624-15758646 CTGCTAATAAAGACATACCTGGG + Intronic
1177727982 21:24993003-24993025 CTGTTATAAAGGTGATAGTTAGG - Intergenic
1177840021 21:26225323-26225345 ATGTTAAAATGCAGATTCCTGGG + Intergenic
1178633702 21:34284096-34284118 CTGTTAAAATGTAGATTCCTGGG + Intergenic
1180371129 22:12037745-12037767 GGGTTAAAAAGAAAATACCTCGG - Intergenic
1180421873 22:12873161-12873183 GTGTTAAAAAGAAAATACCTCGG + Intergenic
1182650475 22:31847400-31847422 CTGCTAATAAAGACATACCTGGG + Intronic
1182875197 22:33685523-33685545 TTGTTAAAATGCAGATTCCTAGG + Intronic
1183089622 22:35512733-35512755 CTGGTAAAAAGGGGGTAACTTGG - Intergenic
949370730 3:3332275-3332297 CTGCTAATAAAGACATACCTGGG + Intergenic
950630492 3:14278805-14278827 ATGTTAAAATGCAGATTCCTGGG + Intergenic
951185622 3:19709461-19709483 TTGTTAAAAAGGAAATAATTTGG - Intergenic
951667888 3:25147187-25147209 TTGTTAAAATATAGATACCTGGG - Intergenic
953352634 3:42227494-42227516 TTGTTAAAACACAGATACCTGGG - Intergenic
953371668 3:42393757-42393779 CTGTTAAAATGCTGATTCCTGGG - Intergenic
954919034 3:54173896-54173918 TTGTTAAAATGCAGATTCCTGGG + Intronic
955276010 3:57547456-57547478 CTATTAAAAAGGATGTACATCGG - Intergenic
955832753 3:63021928-63021950 CTGTTAAAAATGAGATTTTTAGG + Intergenic
956061445 3:65352110-65352132 CTTTTATAAAGGAGATACTAGGG + Intergenic
956627008 3:71276589-71276611 ATTTTAAAAAGGATATACTTAGG - Intronic
958964061 3:100538328-100538350 CTTTTAAAAAAGAAAGACCTAGG - Intronic
960289832 3:115870585-115870607 GTGTTAAAATGCAGATTCCTGGG - Intronic
960985493 3:123277463-123277485 CTTTTAAAAATGAGCCACCTGGG + Intergenic
961409959 3:126713230-126713252 CAGTTAAAAAGGAGTTGCCCGGG + Intronic
961676750 3:128572255-128572277 CTGTCAAAATGAAGATGCCTGGG + Exonic
961953428 3:130774079-130774101 CTGTTATTAAGGAGATAAGTAGG - Intergenic
963540037 3:146574186-146574208 CTCTTAAAAATGAGATAGATTGG - Intergenic
963901731 3:150739566-150739588 CTGTTAAAACGGAATAACCTGGG + Intergenic
963951175 3:151203086-151203108 GTGTTTAAAAAGACATACCTGGG + Exonic
965420737 3:168455450-168455472 CTGTTAAAATGCAGATTCATGGG - Intergenic
965868224 3:173232744-173232766 CTGCTAGAAAGGAGATTCCAGGG + Intergenic
966057004 3:175705929-175705951 CTCTAAGAAAGGACATACCTTGG + Intronic
966138839 3:176731776-176731798 CTGCTAATAAAGACATACCTGGG - Intergenic
966486256 3:180474529-180474551 CTGCTAATAAAGACATACCTAGG + Intergenic
967997188 3:195175528-195175550 CTGTTCAGATGGAGATTCCTAGG + Intronic
1202749062 3_GL000221v1_random:139357-139379 GTGTTAAAAAGAAAATACCTCGG - Intergenic
969295035 4:6264785-6264807 CTGTTAAAATGCAGATTCCTGGG + Intergenic
970340701 4:15103629-15103651 CTGCTAATAAAGACATACCTGGG - Intergenic
970420611 4:15902475-15902497 CTGTTTAAAAGAGGATAACTGGG - Intergenic
970552689 4:17198977-17198999 CTGTTAATAAAGACATACCTGGG + Intergenic
971865736 4:32169234-32169256 CTATTAACAACTAGATACCTGGG - Intergenic
972744237 4:41917440-41917462 CTGTTAATAACCAGAAACCTGGG - Intergenic
972993886 4:44855384-44855406 TTATTAAAAAGAAGATATCTAGG + Intergenic
975299147 4:72768983-72769005 CTATTAAAAACTAGAGACCTTGG + Intergenic
975740403 4:77424047-77424069 CTGTTATAAAGGGGCTTCCTTGG - Intronic
976108821 4:81648443-81648465 CTGCTAGAAAAGAGATGCCTTGG - Intronic
976737769 4:88328182-88328204 TTGTTAAGAAGTAGATATCTGGG - Intergenic
976962167 4:90991039-90991061 GTGTTAAAAAGGCAATTCCTGGG - Intronic
977332501 4:95655149-95655171 CAGTGAAAAATAAGATACCTGGG - Intergenic
980080439 4:128338384-128338406 ATGTTAAAAAAGAGAGACTTGGG + Intergenic
980429925 4:132681360-132681382 GTGTTATAAAGTAGATACCAGGG + Intergenic
980911616 4:138999431-138999453 CTGTTAAAATGCAGGTTCCTGGG + Intergenic
980954098 4:139410686-139410708 CTGTTTAAAATGAGGTACCTAGG + Intronic
981848548 4:149199570-149199592 CAGTTACAAAGTAAATACCTTGG + Intergenic
983199614 4:164846724-164846746 CAGCTAAACAGGAGACACCTGGG + Intergenic
983697133 4:170546100-170546122 CTGTTAACATGTGGATACCTAGG - Intergenic
983904030 4:173166667-173166689 CTGATTAACAGGAGATTCCTGGG + Intergenic
984414365 4:179437812-179437834 TTCTTAAAAGGGAAATACCTTGG + Intergenic
984795587 4:183657852-183657874 TTGTTAAACTGGAGATTCCTGGG + Intronic
985416138 4:189737396-189737418 CTGCTAATAAAGACATACCTGGG - Intergenic
1202752733 4_GL000008v2_random:24081-24103 GTGTTAAAAAGAAAATACTTCGG + Intergenic
985861059 5:2471102-2471124 GTGTGCAAAAGGAGATCCCTGGG + Intergenic
987465450 5:18266568-18266590 TTGTTAAAAAGCAGATACAGTGG - Intergenic
987567257 5:19606847-19606869 TTTTTAAAAAGTAAATACCTAGG + Intronic
987814017 5:22877591-22877613 CCCTGAAAAAGGAGATAACTGGG - Intergenic
988940661 5:36142484-36142506 TTTTAAAAAAGGAAATACCTTGG + Exonic
989247154 5:39266940-39266962 CTCAGAAAAAGTAGATACCTAGG - Intronic
989759970 5:45002352-45002374 TTGTTAAAATGTAGATTCCTGGG - Intergenic
989965224 5:50459019-50459041 ATGATAAAAAGGAGATCTCTGGG - Intergenic
990340848 5:54821558-54821580 CTGTTAAAGAGAAAATATCTGGG - Intergenic
990393794 5:55355436-55355458 CTGTTAAGAAGGAGGCACCTGGG + Intronic
990666385 5:58077198-58077220 CTGCAAAAAAGCAGAGACCTTGG + Intergenic
990777283 5:59316321-59316343 CTGTTTAAAAGAAACTACCTGGG + Intronic
991433066 5:66568390-66568412 CTGTTAAAATGCAGATTCCTAGG - Intergenic
992017297 5:72588553-72588575 CTTTTAGAAAGCAGATGCCTTGG + Intergenic
993040173 5:82805325-82805347 CTGTTTAAATGGAGAACCCTAGG - Intergenic
993331062 5:86600505-86600527 CTGTTAAAAATAAAATACTTAGG + Intergenic
993444002 5:87989756-87989778 CTGTTAAAGTGGAGATATATGGG + Intergenic
994100543 5:95886789-95886811 CTGTGAAAATGCAGATACTTGGG + Exonic
994752101 5:103750893-103750915 ATGTTAAATAGGTGATTCCTAGG + Intergenic
998737596 5:145160319-145160341 CTGTTAAATATAAGATAACTAGG - Intergenic
999449429 5:151667122-151667144 CTGATAAAATGCAGATTCCTTGG - Intronic
1000534842 5:162467777-162467799 ATGTGAAAAAGGAGAAAACTGGG - Intergenic
1001458603 5:171888080-171888102 CTGGAAAAAAAGAGATCCCTGGG + Intronic
1002107290 5:176886417-176886439 ATGTTGAAAGGGAGATTCCTGGG + Intronic
1003479400 6:6517334-6517356 TTGTTAAAAATGACATTCCTGGG - Intergenic
1003684338 6:8286115-8286137 TTGTTAAAATGGTGATTCCTAGG - Intergenic
1003762802 6:9199505-9199527 TTGTTAAAATGCAGATTCCTGGG + Intergenic
1003786106 6:9488974-9488996 ATGTTAAAAATAAGATACTTAGG + Intergenic
1004899824 6:20183780-20183802 CTGCTGATAAGGATATACCTGGG + Intronic
1005692944 6:28324461-28324483 CATTTAAAATGGAGATTCCTGGG + Intergenic
1006719418 6:36140496-36140518 TTGTTAAAATGCAGATTCCTGGG + Intronic
1007980352 6:46149076-46149098 CTGCTAATAAAGACATACCTGGG + Intergenic
1008755948 6:54795925-54795947 CTGCTAATAAAGACATACCTGGG + Intergenic
1009912558 6:69949833-69949855 CTGTTAAAAAATAAATAACTAGG + Intronic
1011134810 6:84088738-84088760 CTCTTAAAATGCAGATTCCTGGG - Intronic
1012691640 6:102320233-102320255 CTGCTAAAAAAGACATAACTGGG - Intergenic
1014181175 6:118385804-118385826 CTGATAAAATGGAGGTACGTGGG - Intergenic
1014476061 6:121873214-121873236 CTGCTAATAAAGACATACCTAGG + Intergenic
1014528332 6:122528297-122528319 CTTTTAGAAAGCAGATAGCTGGG + Intronic
1014630278 6:123781057-123781079 CTTTTAAAGAGGAGAAACCAAGG - Intergenic
1014989043 6:128051301-128051323 CTGATAAAAAGGAGATTGCTAGG - Intronic
1015066538 6:129036230-129036252 CTATTAAAAGTGAAATACCTAGG - Intronic
1016061882 6:139639024-139639046 TTTCTAAAAAGGAGATGCCTGGG + Intergenic
1016262319 6:142187039-142187061 CTTTTAAAAATGAAATATCTGGG - Intronic
1016477487 6:144442877-144442899 TTGTTAAAATGTAGATTCCTAGG + Intronic
1016639798 6:146335707-146335729 CTGTTAAAATGGAGATTTCCGGG - Intronic
1017346645 6:153390951-153390973 CTGCTGAAAAAGACATACCTGGG - Intergenic
1021090006 7:16472384-16472406 TTGTTAAAACGCAGATTCCTAGG - Intronic
1021677067 7:23091091-23091113 TTTTTAAAAAGGAAATAACTGGG + Intergenic
1022881028 7:34587646-34587668 CTTTTAAACAGGAAATTCCTTGG + Intergenic
1024038217 7:45526580-45526602 CTGTTAAAAAACAGATTGCTGGG + Intergenic
1026660950 7:72301974-72301996 CTGGAAAAAAGAAGAGACCTTGG + Intronic
1027606640 7:80307780-80307802 CTGTTCAAAATGAGATGTCTTGG - Intergenic
1028957671 7:96712289-96712311 CTGCTAATAAAGACATACCTGGG - Intergenic
1028971783 7:96867365-96867387 CTGTTAAACAGGAGATAATTCGG + Intergenic
1029657587 7:101937145-101937167 CTGTCACAAAGTAGATGCCTGGG + Intronic
1030531982 7:110722581-110722603 TTGCTAAAAAGGAAATACATTGG - Intronic
1030536831 7:110777788-110777810 CTGTTAAAAAAGATATAGTTTGG + Intronic
1030619000 7:111769365-111769387 TTGTTAAAATGCAGATTCCTAGG - Intronic
1031546345 7:123054655-123054677 CTGCTAATAAAGACATACCTGGG - Intergenic
1031687162 7:124745049-124745071 CTGGGAAAAAGGAGATAGCCTGG + Intergenic
1033453144 7:141479336-141479358 ATGCTATAAAGGAGATACCCTGG + Exonic
1035953708 8:4052628-4052650 CTTTTCCAAAGGAGATGCCTAGG - Intronic
1036739228 8:11346748-11346770 CTGTTAAAATGCAGATTCCCTGG + Intergenic
1038563721 8:28602089-28602111 CTTTTTAAAAGGAAATAACTAGG + Intronic
1039854820 8:41403082-41403104 CTGTTAAAATGCAGACTCCTGGG + Intergenic
1041348586 8:56926756-56926778 TTGTTAAAATGCAGATCCCTGGG + Intergenic
1042417126 8:68534055-68534077 TTGTTAAAAATGAGATTCCTTGG + Intronic
1042761650 8:72277480-72277502 CTGCTAATAAAGACATACCTAGG - Intergenic
1043214515 8:77569296-77569318 CTGTTAAAAATGAGAGAAATTGG + Intergenic
1043381360 8:79705631-79705653 GTGTTAAAATGCAGATTCCTGGG + Intergenic
1043446314 8:80322862-80322884 TTTTTAAAAAGGAGAGAACTAGG + Intergenic
1044349497 8:91147129-91147151 CTGTTAAAATGTTGATCCCTGGG + Intronic
1045206745 8:100050136-100050158 TTGTTAAAATAGAGATTCCTGGG - Intronic
1045244991 8:100435063-100435085 TTGTTAAAAAGCAGATGGCTGGG + Intergenic
1045455117 8:102370424-102370446 CAGTTAAAAAGAATATCCCTGGG - Intronic
1046415985 8:113914686-113914708 GGATTACAAAGGAGATACCTTGG - Intergenic
1047115856 8:121841356-121841378 CTGCTAAGAAAGACATACCTGGG - Intergenic
1048151979 8:131903369-131903391 TTGTTGAAAAGCAGATTCCTAGG - Intergenic
1048797044 8:138160185-138160207 CAGTCAAAAAGGAGATCCATAGG - Intronic
1050319702 9:4438888-4438910 CTGCTAATAAAGACATACCTAGG - Intergenic
1051222732 9:14867274-14867296 CAGGGAAAAAGAAGATACCTGGG - Intronic
1051470564 9:17435861-17435883 CCGTAAAAAAGGAGCTACCCTGG - Intronic
1051602785 9:18891315-18891337 CGGTTAAAAAACAGCTACCTGGG - Intronic
1051939320 9:22485923-22485945 GTGTTAAAAAGGAAATAACAAGG + Intergenic
1052166268 9:25333042-25333064 CTCTTAAAATGCAGATTCCTGGG + Intergenic
1052821827 9:33143605-33143627 TTGTTAAAATGCAGATTCCTGGG - Intronic
1054339113 9:63839775-63839797 CTGCTACAAAGAAGATACTTAGG + Intergenic
1055114458 9:72591872-72591894 TTGTTAAAATGCAGATATCTGGG + Intronic
1056905765 9:90646333-90646355 TTGCTAAAAAGCAGATAGCTGGG - Intergenic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1203717702 Un_KI270742v1:169447-169469 GTGTTAAAAAGAAAATACCTCGG - Intergenic
1203533523 Un_KI270743v1:8786-8808 GTGTTAAAAAGAAAATACCTCGG + Intergenic
1203636927 Un_KI270750v1:121644-121666 CTGCTAATAAAGACATACCTGGG + Intergenic
1186139056 X:6551902-6551924 TTGTGAAAAAGGATATAACTTGG + Intergenic
1187721902 X:22160103-22160125 CTGCTAATAAAGACATACCTGGG + Intronic
1188087381 X:25916633-25916655 ATTTTAAAAAGGAAAAACCTTGG - Intergenic
1188341107 X:29003090-29003112 GTGTTAAAAAGGAGTTTCCTGGG + Intronic
1188767733 X:34117043-34117065 ATGGAAAAAAGGAGATACATTGG + Intergenic
1192366233 X:70475995-70476017 TTGTTAAAATGCAGATTCCTGGG + Intronic
1193324257 X:80161171-80161193 CTATAAAAAATAAGATACCTAGG + Intergenic
1194178090 X:90677218-90677240 CTGTTAAAAATGAGAAAAATGGG + Intergenic
1194508447 X:94762512-94762534 CTGTTAAAATTTAGATATCTGGG + Intergenic
1194548638 X:95269777-95269799 CTGCTAATAAAGACATACCTTGG + Intergenic
1194799716 X:98257403-98257425 CTACTAAAAATAAGATACCTAGG + Intergenic
1195088233 X:101433913-101433935 TTTTTAAAAAGAAGATATCTTGG + Intronic
1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG + Intergenic
1195816927 X:108897771-108897793 CTGCTAATAAGAAAATACCTGGG - Intergenic
1196277519 X:113784790-113784812 CTGCTAATAAAGACATACCTGGG + Intergenic
1197700310 X:129594746-129594768 TTGTTAAAAAGCAGATTCCTAGG + Intergenic
1197965026 X:132051000-132051022 CTTTTAAAATGTGGATACCTAGG - Intergenic
1198184507 X:134240244-134240266 CTGTTACAAAGGAAATCACTAGG - Intronic
1198443761 X:136690684-136690706 TTGTTAAAATGAGGATACCTGGG + Exonic
1198586320 X:138126043-138126065 TGGTTAACAAGGAGATAACTTGG - Intergenic
1198625911 X:138573658-138573680 CTGTTAAAAAAAAGATACATCGG - Intergenic
1199536029 X:148904222-148904244 CTGTTGAAAAGGCAAAACCTAGG + Exonic
1200524756 Y:4259375-4259397 CTGTTAAAAATGAGAAAAATGGG + Intergenic
1201171862 Y:11274384-11274406 GGGTTAAAAAGAAAATACCTCGG - Intergenic
1201556753 Y:15270933-15270955 CTGTTAAAAAGAAAATAGATAGG + Intergenic