ID: 1118877632

View in Genome Browser
Species Human (GRCh38)
Location 14:69798156-69798178
Sequence GAGCAGAAGCAGAGAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118877623_1118877632 15 Left 1118877623 14:69798118-69798140 CCTGTGTGTTTCAGGCTGGGAGC No data
Right 1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG No data
1118877629_1118877632 -7 Left 1118877629 14:69798140-69798162 CCAGGCTTGGGGCGTGGAGCAGA No data
Right 1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118877632 Original CRISPR GAGCAGAAGCAGAGAGAGGT GGG Intergenic
No off target data available for this crispr