ID: 1118879949

View in Genome Browser
Species Human (GRCh38)
Location 14:69817446-69817468
Sequence AAGAGAAAGGCGAAGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118879949_1118879952 -6 Left 1118879949 14:69817446-69817468 CCTGCTGCCTTCGCCTTTCTCTT No data
Right 1118879952 14:69817463-69817485 TCTCTTCCAAGAATCCAGAGTGG No data
1118879949_1118879954 3 Left 1118879949 14:69817446-69817468 CCTGCTGCCTTCGCCTTTCTCTT No data
Right 1118879954 14:69817472-69817494 AGAATCCAGAGTGGCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118879949 Original CRISPR AAGAGAAAGGCGAAGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr