ID: 1118888970

View in Genome Browser
Species Human (GRCh38)
Location 14:69891544-69891566
Sequence CAGGGGGTAGGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3463
Summary {0: 1, 1: 1, 2: 21, 3: 322, 4: 3118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118888970_1118888987 25 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888987 14:69891592-69891614 CTACCCTCCTCAGGGCCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 247
1118888970_1118888982 17 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888982 14:69891584-69891606 TCTCCCTCCTACCCTCCTCAGGG 0: 1
1: 0
2: 3
3: 59
4: 520
1118888970_1118888976 -8 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888976 14:69891559-69891581 ACCCCCTGAACTGCATCTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 135
1118888970_1118888989 27 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888989 14:69891594-69891616 ACCCTCCTCAGGGCCAGGAGGGG 0: 1
1: 0
2: 7
3: 40
4: 403
1118888970_1118888981 16 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888981 14:69891583-69891605 GTCTCCCTCCTACCCTCCTCAGG 0: 1
1: 0
2: 5
3: 37
4: 374
1118888970_1118888988 26 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888988 14:69891593-69891615 TACCCTCCTCAGGGCCAGGAGGG 0: 1
1: 0
2: 0
3: 26
4: 184
1118888970_1118888985 22 Left 1118888970 14:69891544-69891566 CCCTCTTCCCTCCCTACCCCCTG 0: 1
1: 1
2: 21
3: 322
4: 3118
Right 1118888985 14:69891589-69891611 CTCCTACCCTCCTCAGGGCCAGG 0: 1
1: 0
2: 2
3: 38
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118888970 Original CRISPR CAGGGGGTAGGGAGGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr