ID: 1118889594

View in Genome Browser
Species Human (GRCh38)
Location 14:69897080-69897102
Sequence AATGTTCCTGGATCACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889594_1118889604 13 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205
1118889594_1118889601 -6 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889601 14:69897097-69897119 AACATTCCATGGAACTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 402
1118889594_1118889599 -8 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889599 14:69897095-69897117 GGAACATTCCATGGAACTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 195
1118889594_1118889600 -7 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889600 14:69897096-69897118 GAACATTCCATGGAACTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 231
1118889594_1118889603 4 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889594 Original CRISPR AATGTTCCTGGATCACATCT GGG (reversed) Intronic