ID: 1118889595

View in Genome Browser
Species Human (GRCh38)
Location 14:69897081-69897103
Sequence GAATGTTCCTGGATCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889595_1118889600 -8 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889600 14:69897096-69897118 GAACATTCCATGGAACTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 231
1118889595_1118889604 12 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205
1118889595_1118889603 3 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406
1118889595_1118889601 -7 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889601 14:69897097-69897119 AACATTCCATGGAACTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 402
1118889595_1118889599 -9 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889599 14:69897095-69897117 GGAACATTCCATGGAACTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889595 Original CRISPR GAATGTTCCTGGATCACATC TGG (reversed) Intronic