ID: 1118889597

View in Genome Browser
Species Human (GRCh38)
Location 14:69897092-69897114
Sequence CCAGTTCCATGGAATGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889597_1118889603 -8 Left 1118889597 14:69897092-69897114 CCAGGAACATTCCATGGAACTGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406
1118889597_1118889604 1 Left 1118889597 14:69897092-69897114 CCAGGAACATTCCATGGAACTGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889597 Original CRISPR CCAGTTCCATGGAATGTTCC TGG (reversed) Intronic