ID: 1118889600 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:69897096-69897118 |
| Sequence | GAACATTCCATGGAACTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 251 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 231} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118889594_1118889600 | -7 | Left | 1118889594 | 14:69897080-69897102 | CCCAGATGTGATCCAGGAACATT | 0: 1 1: 0 2: 1 3: 15 4: 206 |
||
| Right | 1118889600 | 14:69897096-69897118 | GAACATTCCATGGAACTGGAGGG | 0: 1 1: 0 2: 1 3: 18 4: 231 |
||||
| 1118889595_1118889600 | -8 | Left | 1118889595 | 14:69897081-69897103 | CCAGATGTGATCCAGGAACATTC | 0: 1 1: 0 2: 0 3: 5 4: 112 |
||
| Right | 1118889600 | 14:69897096-69897118 | GAACATTCCATGGAACTGGAGGG | 0: 1 1: 0 2: 1 3: 18 4: 231 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118889600 | Original CRISPR | GAACATTCCATGGAACTGGA GGG | Intronic | ||