ID: 1118889602

View in Genome Browser
Species Human (GRCh38)
Location 14:69897103-69897125
Sequence GCACTGCCCCTCCAGTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889602_1118889604 -10 Left 1118889602 14:69897103-69897125 CCATGGAACTGGAGGGGCAGTGC 0: 1
1: 0
2: 3
3: 17
4: 199
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889602 Original CRISPR GCACTGCCCCTCCAGTTCCA TGG (reversed) Intronic