ID: 1118889603

View in Genome Browser
Species Human (GRCh38)
Location 14:69897107-69897129
Sequence GGAACTGGAGGGGCAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889597_1118889603 -8 Left 1118889597 14:69897092-69897114 CCAGGAACATTCCATGGAACTGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406
1118889595_1118889603 3 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406
1118889594_1118889603 4 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889603 14:69897107-69897129 GGAACTGGAGGGGCAGTGCCTGG 0: 1
1: 0
2: 5
3: 53
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889603 Original CRISPR GGAACTGGAGGGGCAGTGCC TGG Intronic