ID: 1118889604

View in Genome Browser
Species Human (GRCh38)
Location 14:69897116-69897138
Sequence GGGGCAGTGCCTGGCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118889597_1118889604 1 Left 1118889597 14:69897092-69897114 CCAGGAACATTCCATGGAACTGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205
1118889602_1118889604 -10 Left 1118889602 14:69897103-69897125 CCATGGAACTGGAGGGGCAGTGC 0: 1
1: 0
2: 3
3: 17
4: 199
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205
1118889594_1118889604 13 Left 1118889594 14:69897080-69897102 CCCAGATGTGATCCAGGAACATT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205
1118889595_1118889604 12 Left 1118889595 14:69897081-69897103 CCAGATGTGATCCAGGAACATTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118889604 14:69897116-69897138 GGGGCAGTGCCTGGCTTTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118889604 Original CRISPR GGGGCAGTGCCTGGCTTTTC TGG Intronic