ID: 1118894766

View in Genome Browser
Species Human (GRCh38)
Location 14:69936536-69936558
Sequence CAGTGGGAGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3668
Summary {0: 1, 1: 4, 2: 33, 3: 345, 4: 3285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118894766_1118894777 18 Left 1118894766 14:69936536-69936558 CCTTCCTCCTTCCCCTCCCACTG 0: 1
1: 4
2: 33
3: 345
4: 3285
Right 1118894777 14:69936577-69936599 GCTCAGTCCCTGGCCTTGTGTGG 0: 1
1: 0
2: 3
3: 31
4: 262
1118894766_1118894778 19 Left 1118894766 14:69936536-69936558 CCTTCCTCCTTCCCCTCCCACTG 0: 1
1: 4
2: 33
3: 345
4: 3285
Right 1118894778 14:69936578-69936600 CTCAGTCCCTGGCCTTGTGTGGG 0: 1
1: 0
2: 0
3: 26
4: 278
1118894766_1118894776 8 Left 1118894766 14:69936536-69936558 CCTTCCTCCTTCCCCTCCCACTG 0: 1
1: 4
2: 33
3: 345
4: 3285
Right 1118894776 14:69936567-69936589 GGCAAGCTTCGCTCAGTCCCTGG 0: 1
1: 0
2: 2
3: 15
4: 95
1118894766_1118894781 29 Left 1118894766 14:69936536-69936558 CCTTCCTCCTTCCCCTCCCACTG 0: 1
1: 4
2: 33
3: 345
4: 3285
Right 1118894781 14:69936588-69936610 GGCCTTGTGTGGGCCATTGCCGG 0: 1
1: 0
2: 2
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118894766 Original CRISPR CAGTGGGAGGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr