ID: 1118894795

View in Genome Browser
Species Human (GRCh38)
Location 14:69936667-69936689
Sequence ACTTGGCTAAAGGCAGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118894795 Original CRISPR ACTTGGCTAAAGGCAGGTCT GGG Intronic
900033174 1:385894-385916 ACTTGGCTAAAAGTAGGACAGGG + Intergenic
900405586 1:2491601-2491623 ACGTGGCCACAGGCAGCTCTAGG - Intronic
901689055 1:10960762-10960784 CCTTGGCTAAATGCAGCTGTGGG - Intronic
905464597 1:38143363-38143385 ATTTGGCCAAAGGCAGTTCTTGG - Intergenic
906003018 1:42443473-42443495 ACTGGGTTAACGGCAGATCTGGG + Intronic
906850735 1:49247465-49247487 AATTGACAAAAGGCAAGTCTAGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
911300337 1:96165132-96165154 ACTGTGCTGAAGGCATGTCTTGG - Intergenic
913015609 1:114731320-114731342 ACTTGGCTACTGTCAGGACTTGG - Intronic
913178853 1:116299738-116299760 ATGTGGGTGAAGGCAGGTCTGGG - Intergenic
915484442 1:156210529-156210551 ACTTGGCCCAGGGCAGGGCTGGG - Exonic
916409361 1:164530087-164530109 ACCTGATAAAAGGCAGGTCTTGG + Intergenic
917814700 1:178695275-178695297 ACTTTGCAAAAAGAAGGTCTTGG - Intergenic
920732615 1:208501875-208501897 AATTGGATAGAGACAGGTCTGGG + Intergenic
1062816213 10:502626-502648 ACTTGGCTGAACTCAGGTATTGG - Intronic
1069089300 10:64180077-64180099 ACATTGCAAAAGGCAGCTCTTGG + Intergenic
1069185667 10:65419422-65419444 AAATGGCTAAGGGCAAGTCTAGG + Intergenic
1069926120 10:71851807-71851829 ACCTGGTCAAAGGCAAGTCTGGG + Intergenic
1071667959 10:87578566-87578588 ACATGGCTGAAGGCAGGCCTAGG - Intergenic
1081695873 11:45108726-45108748 ACATAGCTACAGGCAGGGCTGGG - Intronic
1081805458 11:45887579-45887601 ACTGGGCCAGAGGCAGGGCTGGG - Intronic
1083473914 11:62903459-62903481 ACTTTGCTAATGGCAGGACCAGG - Intergenic
1083948948 11:65943262-65943284 CCTTGGCAGAGGGCAGGTCTGGG - Intergenic
1084330145 11:68425369-68425391 ACTGGGCTCACGGCAGGTCTCGG - Intronic
1084875762 11:72131575-72131597 ACTTGGATGAAGGCTGGCCTTGG + Intronic
1088002519 11:104899448-104899470 ACTTGGCTGGAGGCTGGCCTAGG - Intergenic
1089331021 11:117688968-117688990 CCTATGCAAAAGGCAGGTCTCGG + Intronic
1090457724 11:126864372-126864394 ACTTGGAGAAAGGCAGGTGTGGG + Intronic
1091103936 11:132900813-132900835 AATTGGCAACAGGCAGTTCTAGG + Intronic
1091762973 12:3099738-3099760 CCTAGACTAAAGGCTGGTCTGGG - Intronic
1094574625 12:31673956-31673978 ACTGGGCTAAAATCAGGTGTGGG + Intronic
1094724636 12:33101392-33101414 ACTTAGAAAAAGGCAGTTCTTGG - Intergenic
1103243602 12:119435921-119435943 AGCTGGCTCTAGGCAGGTCTAGG + Intronic
1104161252 12:126182814-126182836 GCTTGGCTGATGGCAGCTCTGGG + Intergenic
1104500549 12:129281764-129281786 GGCTGGCCAAAGGCAGGTCTTGG - Intronic
1105050266 12:133043620-133043642 AAATGGCTAACGGCAGGTCTGGG - Intronic
1105679212 13:22708125-22708147 ACTTAGCATAAGGCAGGGCTGGG - Intergenic
1112114280 13:96335297-96335319 CCTTGGTCAAAAGCAGGTCTGGG - Intronic
1112554272 13:100452293-100452315 AGATGGCTAAAGGCAGGGCCAGG - Intronic
1112882259 13:104122554-104122576 AACTGGGTAAAGGCAGGGCTTGG + Intergenic
1116541989 14:46110518-46110540 AATTGGCCCAGGGCAGGTCTTGG - Intergenic
1118305421 14:64651081-64651103 ACATGGCTACAGGCAGCTCTAGG - Intergenic
1118894795 14:69936667-69936689 ACTTGGCTAAAGGCAGGTCTGGG + Intronic
1118979780 14:70707100-70707122 TTTTGGCAGAAGGCAGGTCTGGG + Intergenic
1119077267 14:71653971-71653993 CATAGGCTAAAGGCCGGTCTTGG - Intronic
1124848332 15:33311968-33311990 ACTTGGCTGAAGTCAGCGCTAGG - Intronic
1125426257 15:39552640-39552662 ACTAGTCTAGAGGCATGTCTAGG - Intergenic
1125512047 15:40297393-40297415 ACTTGGTTAGATGCGGGTCTGGG - Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1128844207 15:70875316-70875338 ACATAACTAAAGGCAGGGCTCGG + Intronic
1129470356 15:75750340-75750362 ACAGGGCTTATGGCAGGTCTGGG + Intergenic
1129640357 15:77370553-77370575 ACTTGGTTAGAGGCAAATCTAGG - Intronic
1129803741 15:78437491-78437513 CCTTGGCTAAAGGCATTTCTGGG + Intronic
1130014572 15:80176607-80176629 ACCTGGCTAATGGCAGGGCTGGG + Intronic
1130394930 15:83493614-83493636 ACTCAGGTAAAAGCAGGTCTGGG - Intronic
1132514267 16:359090-359112 ACGTGGGTGACGGCAGGTCTGGG - Intergenic
1133316577 16:4888301-4888323 ACATGGCACAGGGCAGGTCTGGG - Intronic
1135063856 16:19292744-19292766 AATTGGCTGAAGTCAGGTCAAGG + Intronic
1137501562 16:49015282-49015304 ACTGGGACAAAGGCAGGTGTGGG - Intergenic
1143586088 17:7851238-7851260 ACGTGGCCAGAGGCAGGTCCTGG + Intronic
1144031201 17:11324960-11324982 AATTGGCAAAAGGAAGATCTGGG - Intronic
1149038993 17:52165067-52165089 ACTTGGAGAGAGGCAGATCTTGG + Intergenic
1150155701 17:62851198-62851220 ACTGGTCTAAAGCCAGGTGTTGG + Intergenic
1151933169 17:77245521-77245543 ACCAGGCCAAAGGCTGGTCTCGG - Intergenic
1152921125 17:83067131-83067153 ACTCTTCTCAAGGCAGGTCTGGG + Intergenic
1153916636 18:9751508-9751530 CTTTGGCTAGAGGCAGGACTTGG + Intronic
1155730982 18:29157710-29157732 ACTTGGCTAAAAGAAGTTATTGG + Intergenic
1156526069 18:37768475-37768497 TCTTTGCTGAAGGCAAGTCTGGG - Intergenic
1158813217 18:61062010-61062032 AATTGGCTAAAAGCAAATCTTGG - Intergenic
1158906008 18:62012489-62012511 ATTTGGCAAAAGCCAGGACTTGG - Intergenic
1160130060 18:76217740-76217762 CCATGGCCACAGGCAGGTCTTGG + Intergenic
1160822841 19:1066451-1066473 CCTTAGCTAAGGGCAGGTCTGGG + Intronic
1161703210 19:5805803-5805825 ACATGGCTAAAGGGCTGTCTGGG - Intergenic
1165257622 19:34589261-34589283 ACTGAGCTAAAGGGAGGTGTGGG + Intergenic
1165708350 19:37992063-37992085 ACGTGGCTAGAGGCAGGGCCTGG + Intronic
1166108253 19:40608125-40608147 CCTTGGCTAGGGGCAGGGCTTGG - Intronic
1167684266 19:50946076-50946098 ACTGGGAAAAAGGCAAGTCTTGG - Intronic
925200272 2:1961720-1961742 ACTTGAGTACAGGCAGGCCTCGG + Intronic
929956918 2:46465110-46465132 GCTTGGCTAATGGCAGAGCTGGG + Intronic
930205855 2:48586069-48586091 ACTTGGCTAAAGCCTGGCCAGGG + Intronic
933917840 2:87014501-87014523 ACTTTGTGAAAGGGAGGTCTAGG + Intronic
934005155 2:87755413-87755435 ACTTTGTGAAAGGGAGGTCTAGG - Intronic
935768112 2:106389505-106389527 ACTTTGTGAAAGGGAGGTCTAGG - Intergenic
941646759 2:168048863-168048885 ACATGGGTAAAGGAAGGTCTGGG - Intronic
1169751859 20:9002845-9002867 AGCTGGCTAAAGGCCAGTCTAGG + Intergenic
1169982651 20:11403953-11403975 GCCTGGCTATAGGCTGGTCTAGG + Intergenic
1174765608 20:53251067-53251089 AATTGGCTAAGGGCATTTCTGGG - Intronic
1175832443 20:61973619-61973641 ACTTTGTGAAAGGCAGGTATGGG + Intronic
1176084654 20:63290437-63290459 TCTTGGCTGAAGCCTGGTCTCGG + Intergenic
1177612000 21:23462505-23462527 ACTTGGCTAAAGGGAGTTCTAGG - Intergenic
1178180928 21:30160612-30160634 ACTTGGCAAAAGGCAGAACCTGG + Intergenic
1180996744 22:19969629-19969651 TCTTGGCTAGGGGCTGGTCTCGG - Exonic
1181667154 22:24406276-24406298 AGATGGCAAAAGGCAGGTCTGGG + Intronic
1182121157 22:27787786-27787808 AATTGGCCACAGGCACGTCTGGG + Intronic
950678691 3:14570022-14570044 ACTTGGCTAGTGGCAGATCTGGG + Intergenic
953237765 3:41121088-41121110 ACTTGGAGAATGGCAGCTCTGGG - Intergenic
953887681 3:46725830-46725852 ACTGGGCTTAAGAAAGGTCTGGG - Intronic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
959789703 3:110344448-110344470 ATTTTGGAAAAGGCAGGTCTTGG - Intergenic
959872593 3:111345542-111345564 ACTGGGCTAAAATCAGGTGTTGG - Intronic
960420138 3:117435330-117435352 ACTTGCCTAAAAGAAGATCTGGG + Intergenic
960631650 3:119738164-119738186 TCTTGGCTGAGGGCAGGTGTTGG + Intronic
961580991 3:127882139-127882161 CCTTGGCTCAAGGCAGCTCAAGG + Intergenic
962428471 3:135297220-135297242 ACTTGGCCAAAGTGAGTTCTTGG - Intergenic
966571957 3:181453782-181453804 ACTTGTCTTAATGGAGGTCTGGG + Intergenic
969867411 4:10084796-10084818 CCTTGGTTAGACGCAGGTCTGGG - Intronic
971310054 4:25517906-25517928 ACTTGGCTAACAGCAGGGATAGG + Intergenic
974466881 4:62269179-62269201 ATATTGCTAAAGGCAGGTCAGGG + Intergenic
977321688 4:95524231-95524253 ACTTAGCTAAATGCAGGGTTAGG - Intronic
979598678 4:122562345-122562367 ACATGGCTAAAGGCAAAGCTTGG + Intergenic
983187093 4:164712532-164712554 TCTTTTCTAAAGGCAGCTCTCGG + Intergenic
984368838 4:178834910-178834932 AGTTGGCCAAAGACAGGTATGGG + Intergenic
985555531 5:556141-556163 ACTGGGCTCCAGGCAGGCCTGGG + Intergenic
986934791 5:12869775-12869797 ACTTAGCTAAAGACAGATCTAGG - Intergenic
989132060 5:38116739-38116761 GCTTGGCTGAAGTCAGATCTTGG + Intergenic
989274155 5:39567222-39567244 AAATGGCTAAAGCCAGGTCCTGG - Intergenic
990410466 5:55535661-55535683 TTCTGGCTAAAGGCAGGTCAAGG - Intergenic
990852205 5:60219097-60219119 ACTTGACAAAAAGCATGTCTAGG + Intronic
991632138 5:68666810-68666832 ACTTGGGAAAAGGCTGGCCTGGG + Intergenic
995532102 5:113101877-113101899 ACCTGGCTGAAGAGAGGTCTCGG - Exonic
995767026 5:115629692-115629714 AACTGGCTATAGGCTGGTCTAGG + Intronic
995786993 5:115841268-115841290 ACTGGTCAAAATGCAGGTCTAGG + Intronic
996095665 5:119396167-119396189 ATATGGCTAAAGGCAGTGCTAGG + Intronic
998476553 5:142427114-142427136 ACTGGGCAAAAGGGAGGTCATGG - Intergenic
1001538996 5:172523928-172523950 ACTGGACTAATGGCAGGTGTTGG + Intergenic
1002740646 5:181432974-181432996 ACTTGGCTAAAAGTAGGACAGGG - Intergenic
1006387538 6:33739696-33739718 ATGTGGCAAAAGGAAGGTCTGGG - Intronic
1008675548 6:53814153-53814175 ACTTGGCTAAAGTAATGTGTAGG + Intronic
1010534932 6:77014419-77014441 ATTTTGCTAAAGACAGGTCAAGG + Intergenic
1011278771 6:85655998-85656020 AGTGGGCAAAAGGCAGGGCTGGG + Intergenic
1016463745 6:144305802-144305824 ACTTGGCCAAGGGCAGTTCCTGG + Intronic
1018128955 6:160709679-160709701 ACTTTGTGAAAGGGAGGTCTAGG - Intronic
1020016852 7:4836263-4836285 ACTGGGCTAAAGGCAGGCGGAGG + Intronic
1023219537 7:37904917-37904939 ACATAGCTAGAGGCAGATCTGGG - Intronic
1023834682 7:44061173-44061195 GCTTGGCCACAGGCAGGGCTTGG - Exonic
1028130535 7:87167105-87167127 ACTTGGCTAAGAGCATATCTAGG + Intronic
1029283501 7:99451304-99451326 ACCTGGTCAAAGGCAAGTCTGGG + Intronic
1032465754 7:132143697-132143719 TCTTACCTAAAGGCAGGTCCTGG + Intronic
1033310066 7:140254852-140254874 ACTTGGTTAATGGCAGCCCTAGG + Intergenic
1034072767 7:148203028-148203050 AATTGGCTAACTGCAGGTTTTGG - Intronic
1036014897 8:4772043-4772065 ACTGGGCTAAAACCAGGTATCGG + Intronic
1039881512 8:41628133-41628155 GGTTGGCTAAAGGCAGGACAAGG + Intergenic
1045062303 8:98420974-98420996 TCATGGCTAAGGGCAGGACTGGG + Intronic
1047846144 8:128807530-128807552 ACTTCCCTAAAGGCAGATGTGGG - Intergenic
1051563802 9:18473213-18473235 ACTTGGTTAAAAGAAGGTTTGGG + Intergenic
1053589760 9:39500136-39500158 TCTTGCCTAAAGAAAGGTCTGGG - Intergenic
1054576535 9:66865171-66865193 TCTTGCCTAAAGAAAGGTCTGGG + Intronic
1055891381 9:81127821-81127843 ACCTGGATAAAGCCAGCTCTAGG + Intergenic
1056186250 9:84137935-84137957 AGTTGGGTAAAGGCAGGACCTGG - Intergenic
1056493897 9:87136636-87136658 ACTGGGCTAAATGAAGGTGTCGG - Intergenic
1058681932 9:107447577-107447599 ACTTCTCTAAAGACAAGTCTGGG - Intergenic
1059757849 9:117310540-117310562 CCTTGGCTAAGGGCTGCTCTTGG - Intronic
1059806510 9:117806850-117806872 ACTAGACTAAAGGCAGGATTTGG - Intergenic
1061463163 9:130756797-130756819 ACTTGGCTATAAGAAGGTTTTGG + Intronic
1187715856 X:22101826-22101848 TCTTTGATAAAGGCATGTCTAGG - Intronic
1187960385 X:24562146-24562168 ACTCTGCTAAGGGAAGGTCTTGG - Exonic
1189936363 X:46073358-46073380 CCTTGGCTAAAGGTATTTCTAGG - Intergenic
1195140840 X:101957974-101957996 ACTTGGAGAAAGGCAGATCAGGG + Intergenic
1197843268 X:130773286-130773308 ACTTGCCTAAAGTCAGGGCCAGG + Intronic
1198045100 X:132893699-132893721 TCTTGGCTTCAGGCAGATCTTGG - Intronic
1201894084 Y:18975233-18975255 ACTTGGCTACAGGTGGGTCCAGG + Intergenic