ID: 1118898093

View in Genome Browser
Species Human (GRCh38)
Location 14:69963699-69963721
Sequence CACCTTGACCTCCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 4, 3: 68, 4: 598}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118898093 Original CRISPR CACCTTGACCTCCCACAGGA AGG (reversed) Intronic
900291241 1:1924400-1924422 CAGCTCGCCCTCCCAGAGGACGG - Exonic
900565132 1:3328425-3328447 CTGCTAGACCTCCCCCAGGAAGG - Intronic
901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG + Intronic
901875459 1:12164806-12164828 CCCCTTCAGCTCCTACAGGATGG - Intergenic
901953796 1:12769905-12769927 CACCTTCTCCTTCCACAGGGAGG + Intergenic
902289117 1:15425274-15425296 CACCTCGGCCTCCCAAAGTATGG - Intronic
902476967 1:16693420-16693442 CACGTAGTCCTCCTACAGGATGG + Intergenic
903243171 1:21997437-21997459 CACCTTGGCCTCCCAAAGTGTGG - Intronic
903330259 1:22593510-22593532 CTCCTTGTCCTGCCACGGGACGG - Exonic
903975142 1:27144758-27144780 CACCTTGGCCTCCCAAAGTGCGG - Intronic
904020621 1:27461908-27461930 CACCTTGGCCTCCCAAAGTGTGG + Intronic
904114676 1:28153043-28153065 CACCTTGGCCTCCCAAATGCTGG - Intronic
904133747 1:28294944-28294966 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
904161824 1:28527759-28527781 CACCTTGGCCTCCCAAAGTGCGG - Intronic
904264722 1:29311623-29311645 CACCTAGAGGCCCCACAGGACGG - Exonic
904912688 1:33947252-33947274 CTCCTTAACCTCCCCCAGGGTGG + Intronic
905000023 1:34660823-34660845 CATCTTTCCCTCCCACAGAACGG + Intergenic
905059131 1:35124227-35124249 CACCTTGGCCTCCCAAAACATGG + Intergenic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
905113209 1:35613287-35613309 CACCTTGGCCTCCCAAAGTGCGG - Intronic
905161998 1:36044688-36044710 CACCTTGGCCTCCCAAAGTGCGG + Intronic
905198309 1:36298753-36298775 CTCCTTGGCCTCCCAAAGCATGG + Intronic
905645176 1:39620297-39620319 CACCTTGGCCTCCCAAAGTGAGG - Intergenic
906452815 1:45966480-45966502 CACCTTGGCCTCCCAAAGTGTGG - Intronic
906992849 1:50756899-50756921 CATCTTGAATTCCCACAGGGAGG - Intronic
907024111 1:51098378-51098400 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
907024409 1:51101360-51101382 CACCTTGGCCTCCCAAACGCTGG - Intergenic
907026827 1:51128441-51128463 CACCTTGGCCTCCCAAAGTGCGG - Intronic
907181173 1:52571610-52571632 CACCTCGACCTCCCAAAGTGAGG + Intergenic
907436751 1:54454595-54454617 TACCTTGACCTCCCAAAGTGCGG + Intergenic
908333101 1:63090901-63090923 TACCTTGGCCTCCCAAAGCATGG + Intergenic
908726588 1:67183284-67183306 CACCTTGGCCTCCCAAAGTGTGG - Intronic
908993484 1:70124274-70124296 CACCTTGGCCTCCCAAAGTGTGG - Intronic
909003202 1:70243798-70243820 CACCTTGGCCTCCCAGAGTTGGG - Intronic
911648794 1:100363904-100363926 CACCTTGGCCTCCCAAAGCGTGG - Intronic
912028461 1:105207838-105207860 CACCTTGGCCTCCCAAAGTCCGG - Intergenic
912386960 1:109275781-109275803 TACCCTGTCCTCCCACAGGGAGG + Intergenic
912422794 1:109557182-109557204 CGCCTCGACCTCCCAAAGGCTGG + Intronic
912537052 1:110382208-110382230 CACCTTGGCCTCCCAAAGTATGG - Intronic
912805512 1:112753651-112753673 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
912917369 1:113828882-113828904 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
913349853 1:117845443-117845465 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
914926477 1:151893120-151893142 CACCTTGGCCTCCCAAAGTGCGG - Intronic
915423863 1:155807456-155807478 CACCTTGTCCTCCCAAAGTCTGG - Intronic
915505958 1:156356704-156356726 CAACTTGGCCTCCCACAGTGTGG + Intronic
915657298 1:157371850-157371872 CACCTTGGCCTCCCAAAGTATGG + Intergenic
915668973 1:157471133-157471155 CTCCTTGACCTCCTACGCGATGG + Intergenic
916018563 1:160773127-160773149 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
916239154 1:162622181-162622203 CACCTTGGCCTCCCAAATGCTGG + Intergenic
916660441 1:166918556-166918578 CTCCTGGACTTCCCACAGGTTGG - Exonic
917351522 1:174083101-174083123 CACCTTCACCTCCCAAATGCTGG - Intergenic
917351639 1:174084205-174084227 CACCTTGACCTCCCAAATTTTGG + Intergenic
917819458 1:178747722-178747744 CTCCTTGAACTCCCACTTGATGG + Intronic
918015018 1:180624678-180624700 CACCTTGGCCTCCCAAAGCGTGG + Intergenic
918199752 1:182255979-182256001 CGCCTTGGCCTCCCACAGTGTGG - Intergenic
918432804 1:184479869-184479891 CACCGTGGCCTCCCAAAGGGCGG + Intronic
918440524 1:184561879-184561901 CACCTTGGCCTCCCAAAGTGGGG + Intronic
918582331 1:186145841-186145863 CACCTTTAACTGGCACAGGATGG - Exonic
918707112 1:187678136-187678158 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
920105570 1:203550740-203550762 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
920228167 1:204452904-204452926 CGCCTTGTCCTCCCAAAGTACGG + Intronic
920435621 1:205944992-205945014 CACCGTGAACTCCCTGAGGAGGG + Intergenic
921266038 1:213421359-213421381 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
921646002 1:217618709-217618731 CACCTTGGCCTCCCAAGGGCTGG - Intronic
922558033 1:226548268-226548290 CACCTTGGCCTCCCAAAGTGGGG + Intergenic
923194595 1:231653026-231653048 CGCCTTGGCCTCCCAAAGGGAGG + Intronic
924355078 1:243164537-243164559 CATCAAAACCTCCCACAGGAAGG - Exonic
924476539 1:244387052-244387074 CACCTTGGCCTCCCAAAGTGCGG - Intronic
924500636 1:244635091-244635113 CACCTCGGCCTCCCAAAGGCTGG + Intronic
924550567 1:245072484-245072506 CACCTTGCCCTCCCAAAGTGTGG + Intronic
1063055133 10:2496150-2496172 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1063729427 10:8678781-8678803 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1064731561 10:18336368-18336390 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1064993486 10:21276575-21276597 CACCTCGGCCTCCCAAAGGCTGG - Intergenic
1065093712 10:22261017-22261039 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1065212524 10:23417981-23418003 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1066109670 10:32184717-32184739 CACCTTGGCCTCCCAAAGTTGGG - Intergenic
1066186567 10:33015094-33015116 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1067164812 10:43856829-43856851 CACCTCGACCTCCCAAATGTTGG - Intergenic
1068168591 10:53362775-53362797 CACCTTGCCCTCCCAAAGTGTGG - Intergenic
1068705903 10:60075071-60075093 CAACCTGAACTCCCAAAGGAAGG - Exonic
1069469217 10:68671988-68672010 CACCTTGGCCTCCCAAGGGCTGG + Intronic
1069672055 10:70215336-70215358 CACCTTGGCCTCCCAAAGTATGG + Intronic
1070023478 10:72609389-72609411 CACCTTGGCCTCCCAAAGCGTGG - Intronic
1070086619 10:73244245-73244267 CACCTTGGCCTCCCAAGGTATGG - Exonic
1070099235 10:73369205-73369227 CACACTCGCCTCCCACAGGATGG - Intergenic
1070113703 10:73508912-73508934 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1070847177 10:79532827-79532849 CACCTGGGCCTCCCAGAGCAGGG - Intergenic
1070926621 10:80227451-80227473 CACCTGGGCCTCCCAGAGCAGGG + Intergenic
1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG + Intergenic
1072346624 10:94514124-94514146 CACCTTGGCCTCCCAAATGCTGG - Intronic
1072532161 10:96329854-96329876 CAGCTTGACCTCCCACAGGAAGG - Intronic
1072629100 10:97133301-97133323 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1073082484 10:100868723-100868745 CACCTTCACCTCCCAGAGAGAGG + Intergenic
1073475373 10:103749137-103749159 CGCCTTGGCCTCCCAAAGGTGGG + Intronic
1074144998 10:110709817-110709839 CACCTTGGCCTCCCAAAGTTGGG + Intronic
1074996994 10:118766295-118766317 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1075062593 10:119267329-119267351 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1075328584 10:121555122-121555144 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1075446531 10:122517324-122517346 CACCTCGGCCTCCCAAAGGCAGG + Intergenic
1075557313 10:123442954-123442976 CCCCTGGAGCTCCCACAGCATGG + Intergenic
1075870243 10:125767388-125767410 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1075901253 10:126044185-126044207 CACCTTGGCCTCCCACTTGCTGG - Intronic
1076461971 10:130653942-130653964 CACCTTGGCCTCCCAAAGTGGGG - Intergenic
1076568035 10:131412159-131412181 CACCCTGATCTCCCAACGGACGG - Intergenic
1076876613 10:133219387-133219409 GACCTGGACCTCCTCCAGGACGG + Intronic
1077894759 11:6445821-6445843 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1078617868 11:12881805-12881827 CACCATGACCTCCCAGTGGGAGG - Intronic
1079042706 11:17073516-17073538 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1079053453 11:17183854-17183876 CTCCTCGACCTCCCAAAGGGAGG - Intronic
1079455669 11:20634116-20634138 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1079849774 11:25516688-25516710 CAGATTGCCCTCCCACATGAGGG - Intergenic
1080222038 11:29917187-29917209 CACATTGGCCTCCCAAAGCACGG - Intergenic
1080521400 11:33070751-33070773 CACCTTGGCCTCCCAAATGCTGG - Intronic
1080692797 11:34572948-34572970 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
1081293548 11:41356618-41356640 CAACTTGACCTCCTAGAGAAGGG + Intronic
1081889098 11:46525341-46525363 CGCCTTGACCTCCCAAAGTGTGG - Intronic
1082048611 11:47751701-47751723 CACCTTGGCCTCCCAAATGCTGG - Intronic
1082731304 11:56801205-56801227 GTCCTTGACTTCCCACAGCATGG - Intergenic
1082788227 11:57329294-57329316 CACCTTGCCCCCACTCAGGAAGG + Intronic
1084292746 11:68185454-68185476 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1084541592 11:69790271-69790293 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1085228465 11:74944068-74944090 CACCTTGGCCTCCCACTGGAAGG + Intronic
1085623442 11:78054467-78054489 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG + Intergenic
1086080226 11:82896425-82896447 CACCTTGGCCTCCCAAAGTGAGG - Intronic
1088541965 11:110921952-110921974 CACCTGGCCCTCTGACAGGAAGG + Intergenic
1088650332 11:111952443-111952465 CACCTTGGCCTCCCAAAGTCTGG - Intronic
1088672667 11:112158235-112158257 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
1088682144 11:112252639-112252661 CACCCTGACTGCCCACAGGCTGG + Intronic
1089176226 11:116550837-116550859 CACCTGGATCTCCCACAGCAGGG - Intergenic
1089254088 11:117184973-117184995 CACCTTGGCCTCCCAGAGTGTGG + Intronic
1089663929 11:120004936-120004958 CAGCTTGACCTCCTCCAGGCAGG - Intergenic
1090644809 11:128758780-128758802 CACAGTGAGCCCCCACAGGAAGG - Intronic
1090975963 11:131680180-131680202 CACCTTGCCCTCCCTCACCAAGG + Intronic
1092146343 12:6217271-6217293 CACCTTGGCCTCCCAAAGCTTGG - Intronic
1092263894 12:6966995-6967017 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1092354241 12:7781598-7781620 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1092546457 12:9456197-9456219 TACCTTGTCCTCCCAAAGTACGG + Intergenic
1092608974 12:10152272-10152294 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1092711859 12:11346700-11346722 CACATTGACCTCTTAAAGGATGG - Intergenic
1093399462 12:18727095-18727117 CACCTTGACTTCCCAAAGCTTGG - Intronic
1093498081 12:19780029-19780051 CACCCTAACCTCCCACAGGTTGG - Intergenic
1094180397 12:27586447-27586469 CACCTTGGCCTCCCAAGGGCTGG - Intronic
1094338824 12:29387924-29387946 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1094506484 12:31065877-31065899 TACCTTGTCCTCCCAAAGTACGG - Intergenic
1094563055 12:31574007-31574029 CACCTTGGCCTCCCACTGTTGGG - Intronic
1095367580 12:41426347-41426369 CACCTTTACATCCCATAGGTAGG + Intronic
1095443743 12:42264414-42264436 CACCTTCACCTCCCAAAGCTAGG + Intronic
1095453375 12:42355486-42355508 CGCCTTGGCCTCCCAAAGCACGG - Intronic
1096026157 12:48363891-48363913 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1096401538 12:51311296-51311318 CACCTCGGCCTCCCACTGGGAGG + Intronic
1096858251 12:54501752-54501774 CACCTCGGCCTCCCAAAGGCTGG + Intronic
1097446911 12:59682819-59682841 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1097840546 12:64317509-64317531 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1098857407 12:75668459-75668481 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1099743017 12:86665617-86665639 CACCTCGGCCTCCCAAAGTACGG + Intronic
1099750932 12:86771596-86771618 CACCTTGGCCTCCCAAAGTCTGG - Intronic
1100321956 12:93503631-93503653 CACCTTGGCCTCCAAAAGTATGG + Exonic
1100399827 12:94219916-94219938 CCCTTTGACCTGCCACAGGAGGG - Intronic
1100497596 12:95140370-95140392 CGCCTTGGCCTCCCAAAGAAAGG - Intronic
1102093144 12:110211107-110211129 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1102251982 12:111393792-111393814 CATCTTGAACTCCGACTGGATGG + Intergenic
1102596291 12:113995037-113995059 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1103664831 12:122555301-122555323 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1104025456 12:125022773-125022795 CACCTTGGCCTCCCAAATGCTGG + Intronic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1104622935 12:130331859-130331881 CATCTTGCCCTCCCACAGTGTGG - Intergenic
1105308308 13:19184315-19184337 TACCATGTCCTCCCACAGGGTGG + Intronic
1105328447 13:19391561-19391583 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1105440533 13:20412086-20412108 CATCTAAACCTCCCACAGGCAGG + Intronic
1105470741 13:20692478-20692500 CACCTTGGCCTCCCAGAGCTGGG + Intergenic
1105863423 13:24438004-24438026 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1106186026 13:27410798-27410820 CACCTTGGCCTCCCAAAGCACGG + Intergenic
1106530553 13:30586731-30586753 CACCTTGGCCTCCCAAAGGTTGG + Intronic
1106722182 13:32446476-32446498 CTCCTTGCCCTGCAACAGGATGG - Intronic
1107432017 13:40348792-40348814 CACCTTGCCCTCTCACATGCTGG + Intergenic
1108870829 13:54983515-54983537 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1109885334 13:68534790-68534812 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1110910018 13:80947771-80947793 CCCCTTGGCCTCCCACAGTGTGG - Intergenic
1112390682 13:98981303-98981325 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1112438329 13:99407605-99407627 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1113554340 13:111219670-111219692 CAACTTCACATCCAACAGGATGG - Intronic
1113758282 13:112829380-112829402 CACCCTGGCATCCCACAGGTGGG - Intronic
1113827169 13:113265298-113265320 CACCTTGCCCTCCCATAGCTGGG - Intronic
1114420495 14:22578314-22578336 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1114440859 14:22746403-22746425 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1115684075 14:35776131-35776153 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1116304472 14:43232894-43232916 CACCTTGACCTTCCAGAGCTGGG - Intergenic
1116541185 14:46104052-46104074 CGCCTTGACCTCCCAAAGTGAGG - Intergenic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1119112179 14:71985368-71985390 CACCTTGGCCTCCCAGAGTGCGG + Intronic
1119225399 14:72941212-72941234 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1119486315 14:74989957-74989979 CATCTTGGCCTCCCAAAGCACGG - Intergenic
1119823608 14:77639535-77639557 CACCTTGGCCTCCCAAATGGTGG - Intergenic
1120610497 14:86635699-86635721 CACCTTGGCCTCCCAAAGCTCGG - Intergenic
1121105551 14:91277261-91277283 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1121204173 14:92147971-92147993 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1122510909 14:102266828-102266850 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1123701195 15:22916050-22916072 CACCTTGACCGGCCACCGGTGGG - Intronic
1124378409 15:29143474-29143496 TGCCCTGACCTCCCACAGGAAGG - Intronic
1127098547 15:55537561-55537583 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1127251516 15:57243533-57243555 CACCTTCACCTCTCACAGGTAGG + Exonic
1127985614 15:64068036-64068058 CACCTTGGCCTCCCAAATGTTGG + Intronic
1129368715 15:75073789-75073811 CACCTTGACCTTCCAAAGTGCGG + Intronic
1129505368 15:76077212-76077234 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1129775106 15:78231377-78231399 CACCTCGGCCTCCCAAAGTACGG + Intronic
1129987428 15:79930478-79930500 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1130320208 15:82835370-82835392 CACCTTGGCCTCCCAAATGCTGG + Exonic
1131082502 15:89548473-89548495 CGCCTTGGCCTCCCAAAGGCTGG + Intergenic
1131519313 15:93101361-93101383 CACCTCGGCCTCCCAAAGGCTGG + Intergenic
1131857113 15:96609321-96609343 TACCTTGACCTCCCAAAATATGG - Intergenic
1132150021 15:99452660-99452682 CACCTTGGCCACACACAGCAGGG - Intergenic
1132420171 15:101659038-101659060 CACCTCGGCCTCCCAAAGGTTGG + Intronic
1132584737 16:701181-701203 CACTTTGAGAGCCCACAGGAGGG + Intronic
1132597030 16:757191-757213 CACCTTGACCTCCCAATGCTAGG - Intronic
1132754676 16:1477169-1477191 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1132935592 16:2479139-2479161 CACTTTGGCCTCCCAAAGGCTGG + Intronic
1133210605 16:4261535-4261557 CGCCTCGGCCTCCCACAGCATGG + Intronic
1133260436 16:4546094-4546116 CACCCTGGCCTCCCAAAGTACGG + Intergenic
1133644240 16:7748122-7748144 CCCCTTGGCCTCCCAAAGTACGG + Intergenic
1133759770 16:8789194-8789216 CACCTTGGCCTCCCAAAGGGTGG - Intronic
1133814568 16:9186767-9186789 CACCATGGCCTCCCAAAGTATGG + Intergenic
1134002488 16:10793644-10793666 CACCTTGGCCTCCCAAATGCTGG - Intronic
1134046424 16:11104374-11104396 CACCTCAGCCTCCCAAAGGATGG + Intronic
1134080375 16:11320703-11320725 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1134360875 16:13530048-13530070 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1134622370 16:15699210-15699232 CACCTTGACCTCCCAAGTGCTGG + Intronic
1135478497 16:22799881-22799903 CGCCTTGGCCTCCCAAAGTAAGG - Intergenic
1135975654 16:27107724-27107746 CACCTTGACCTCCCAAAGTGTGG + Intergenic
1136103262 16:28010809-28010831 CATCTAGAACTCCCACAGGACGG + Intronic
1136178637 16:28535957-28535979 CTCCTTGGCCTCCCAAAGGCTGG + Intronic
1136254700 16:29030226-29030248 CACCTCGGCCTCCCAAGGGAGGG + Intergenic
1136360301 16:29775101-29775123 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1136493735 16:30628282-30628304 CATCTTGGCCTCCCAAATGATGG - Intergenic
1137286601 16:47021362-47021384 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1137946435 16:52737190-52737212 CACCTTGATCTCCCAAAGTGTGG + Intergenic
1137995365 16:53205088-53205110 CACCTTGGCCTCCCCAAGGCTGG + Intronic
1138439470 16:57025524-57025546 CACCTTGACGTCCCCCATAATGG - Exonic
1138534257 16:57651606-57651628 CACCTTCTCCTTCCACAGTAAGG + Exonic
1139823800 16:69741125-69741147 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1140108837 16:71985813-71985835 CACCTTGGCCTCCCAAATGCTGG + Intronic
1140109188 16:71988441-71988463 CACCTTGGCCTCCCAAAGTATGG + Intronic
1140331120 16:74057814-74057836 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1140451322 16:75073038-75073060 CACCTTGGCCTCCCAAAGTATGG - Intronic
1140789166 16:78374033-78374055 CGCCTTGGCCTCCCACAGTGTGG + Intronic
1141356296 16:83349847-83349869 CACCTTGGCCTCCCAAATGCTGG + Intronic
1141601441 16:85128962-85128984 AACCTTAGCCTCCCACAGGACGG + Intergenic
1142192775 16:88725515-88725537 CACCTTTCCCCACCACAGGATGG - Exonic
1142348394 16:89568705-89568727 CACCATGGCCTCCCAAAGGCTGG - Intergenic
1142358356 16:89614544-89614566 CACCTCGGCCTCCCACAGTGTGG - Intronic
1142540324 17:653905-653927 CACCTCGGCCTCCCACAGCGCGG - Intronic
1143115731 17:4581003-4581025 CACCTCAGCCTCCCAAAGGAGGG + Intergenic
1143549359 17:7620215-7620237 CACTTTGGCCTCCCAAAGGAGGG - Intronic
1143560346 17:7690195-7690217 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1143577939 17:7805600-7805622 CACCTTGCCCTCCCAAAGCTTGG - Intronic
1143714826 17:8759377-8759399 TGCCTTGGCCTCCCAAAGGAGGG - Intergenic
1143726959 17:8854942-8854964 CACCTTGGCCTCCCAAATGTTGG - Intronic
1143896804 17:10142920-10142942 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1144193568 17:12868902-12868924 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1144393627 17:14820737-14820759 CACCTGGGCCTCCCAAAGGACGG - Intergenic
1144962860 17:19055793-19055815 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1144972301 17:19118728-19118750 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1145119024 17:20239507-20239529 CAACATGACCTTCCATAGGAAGG + Intronic
1145137881 17:20426190-20426212 CACCTCGGCCTCCCAAAGTATGG + Intergenic
1145949242 17:28803254-28803276 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1146357647 17:32147572-32147594 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1146594457 17:34156968-34156990 CGCCCTGACATCCCCCAGGATGG - Intronic
1147243302 17:39104976-39104998 TACCTTGCCCTTCTACAGGAAGG + Intronic
1147274177 17:39301340-39301362 CACCTTGACCTCCCAAGTGATGG - Intronic
1147274955 17:39308224-39308246 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1147783711 17:42962780-42962802 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1147981115 17:44274674-44274696 CGCCTTGACCTCCCAAAGTGCGG - Intergenic
1148802683 17:50241542-50241564 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
1148825409 17:50389845-50389867 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1148847647 17:50538622-50538644 CAGCTGGGCCTCACACAGGAGGG + Intronic
1150050197 17:61954526-61954548 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1150207565 17:63420536-63420558 TGCCCTGTCCTCCCACAGGAGGG - Exonic
1150269813 17:63856636-63856658 CACCTTGGCCTCCCAAAGTGGGG + Intergenic
1150866440 17:68855640-68855662 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1151162709 17:72178920-72178942 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1151304287 17:73253109-73253131 CACCTTGGCCTCCCAAATGCTGG - Intronic
1151506269 17:74529540-74529562 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1152405236 17:80094462-80094484 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1152495155 17:80665791-80665813 CACTTTGGCCTCCCACAGCTGGG + Intronic
1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG + Intronic
1152916801 17:83042116-83042138 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1152943076 17:83182626-83182648 GACATTGAACTTCCACAGGAGGG + Intergenic
1153533178 18:6070566-6070588 CACTTTGACCTCCCAAAGTGTGG - Intronic
1153869275 18:9301942-9301964 CACCTCGACCTCCCAAAGTGTGG - Intergenic
1154268784 18:12901413-12901435 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1155039087 18:22050008-22050030 CACCTTGGCCTCCCAAAGTCTGG - Intergenic
1155323392 18:24641993-24642015 CACCTTGGCCTCCCTAAGTATGG + Intergenic
1155974876 18:32118283-32118305 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1155983872 18:32209236-32209258 CACCTTGGCCTCCCAAAGGCCGG - Intronic
1156003312 18:32410596-32410618 CATCTTGGCCTCCCAAAGCATGG + Intronic
1157107578 18:44789049-44789071 CGCCTTGACCTCCCAAAGTGTGG + Intronic
1157264747 18:46208714-46208736 CACCCTGACCTCCCAGATGCTGG + Intronic
1157395833 18:47340079-47340101 CACATTGGAATCCCACAGGAGGG + Intergenic
1157872576 18:51244224-51244246 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1158070395 18:53463135-53463157 CACCTCCACCTCCCACTGAAAGG + Intronic
1158429584 18:57373087-57373109 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1158940098 18:62399819-62399841 TTTCTTGTCCTCCCACAGGAAGG - Intergenic
1159025049 18:63176044-63176066 CAGCTTGAACTCCCACAGCGTGG + Intronic
1159533767 18:69688768-69688790 CACCTCAACCTCCCAAAGCAAGG + Intronic
1159960982 18:74555559-74555581 CTCCTTGACCCCTGACAGGAAGG - Intronic
1160475422 18:79181057-79181079 CACCTTGGCCTCCCAAAGTGGGG + Intronic
1160736828 19:666789-666811 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1161224910 19:3139192-3139214 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1161602560 19:5193455-5193477 CAGCTGGACCTCACAAAGGAAGG - Intronic
1161782191 19:6300393-6300415 AACCTTGACCTCCCAAAGTGTGG + Intergenic
1162307299 19:9882948-9882970 CACCTTGGCCTCCCAAAGTGGGG - Intronic
1162317907 19:9952030-9952052 CGCCTTGACCTCCCAAAGTGTGG - Intergenic
1163086634 19:14985712-14985734 CTCCTTGGCCTCCCAAAGGCTGG - Intronic
1163256710 19:16160492-16160514 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1163599251 19:18238484-18238506 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1163678757 19:18668851-18668873 CGCCTTGAACTCCCACTGGTCGG - Exonic
1164060229 19:21666456-21666478 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1164631197 19:29762541-29762563 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1164850308 19:31477811-31477833 CACCTTGGCCTCCCAAAGGGCGG + Intergenic
1165311861 19:35033357-35033379 CACCTTGACCTCAGGCAGGGAGG - Intronic
1165340839 19:35211072-35211094 CACGTTGGCCTCCCACATGGTGG - Intergenic
1166136569 19:40780735-40780757 CACCATGGCCTCCCAAAGCACGG - Intronic
1166609594 19:44178929-44178951 CACCTCGGCCTCCCAAAGTACGG - Intergenic
1166761293 19:45225869-45225891 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1166792781 19:45407805-45407827 CGCCTCGGCCTCCCAAAGGATGG - Intronic
1166848607 19:45746213-45746235 CACCTTGGCCTCCCAAAGTTCGG + Intronic
1166867794 19:45851325-45851347 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1167604114 19:50471211-50471233 CACCTTGGCCTCCCAAATGCTGG + Intronic
1167680813 19:50919502-50919524 CACCTTGATCACCCATAAGAGGG - Intergenic
1167824764 19:51962164-51962186 GAGCTTGACCTCCCAGATGAAGG - Intergenic
1168606073 19:57760960-57760982 CACCTTGGCCTCCCACAGTGCGG - Intergenic
1168619610 19:57867627-57867649 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1202654271 1_KI270708v1_random:4666-4688 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1202710983 1_KI270714v1_random:19246-19268 CACGTAGTCCTCCTACAGGATGG + Intergenic
925004830 2:433821-433843 CACCTTGGCCCCTCAAAGGAGGG + Intergenic
925426041 2:3749657-3749679 CACCTTGGCCGCCCACACGCTGG - Intronic
926198876 2:10779356-10779378 CACCTTGGCCTCCCAAATGTTGG + Intronic
927012829 2:18923685-18923707 AATCTTGAACTCCCATAGGAGGG + Intergenic
927066741 2:19479428-19479450 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
927448521 2:23186759-23186781 CACATTAACCCCACACAGGAGGG - Intergenic
927796249 2:26051497-26051519 CACCTTGGCCTCCCAAAGTGTGG - Intronic
927970116 2:27300419-27300441 CACCTTGGCCTCCCAAATGCTGG + Intronic
928099879 2:28430745-28430767 CACAGCTACCTCCCACAGGAAGG - Intergenic
929111438 2:38408364-38408386 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
929519640 2:42636289-42636311 CACCTTGGCCTCCCAAAGGCTGG - Intronic
929665666 2:43832004-43832026 CACATACACCTCCCCCAGGAAGG + Exonic
929873721 2:45778782-45778804 CACCTTGAGCTCCCACTAGGTGG - Intronic
930116991 2:47726513-47726535 CACCTTGGCCTCCCAAAGTGTGG + Intronic
930806878 2:55499415-55499437 CACCTTGGCCTCCCAAATGCTGG + Intergenic
930853170 2:55983618-55983640 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
931454023 2:62392952-62392974 CACCTTGGCCTCCCAAATGCTGG + Intergenic
931644395 2:64408422-64408444 GTCCCTGACATCCCACAGGAGGG + Intergenic
932462555 2:71892499-71892521 CCCCTTCACCTTCCACAAGAGGG + Intergenic
933247672 2:79994164-79994186 CACCTTGGCCTCCCAAATGCTGG + Intronic
933525818 2:83437285-83437307 CACATTGACCTCCCTCAGACAGG - Intergenic
933788160 2:85860622-85860644 CGCCTTGGCCTCCCAAAGGTCGG - Intronic
934769700 2:96899997-96900019 CACTCTGACCTCCACCAGGAAGG + Intronic
935042495 2:99446739-99446761 CACCTTGGCCTCCCAAAGTGGGG + Intronic
935265052 2:101387016-101387038 CACCGTGTCCACCCACAAGAAGG - Exonic
936481689 2:112890728-112890750 CACTTTCCCCTCCCACAGGTAGG + Intergenic
936741295 2:115512346-115512368 CACCTAGGCCTCCCAAAGGGAGG + Intronic
936822939 2:116545132-116545154 CAGCTTGATCTTCCTCAGGATGG - Intergenic
937485555 2:122311304-122311326 CACCTTGGCCCCCCAAAGGCTGG + Intergenic
937485830 2:122314019-122314041 CACCTTGGCCCCCCAAAGGCTGG - Intergenic
937846816 2:126587599-126587621 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
938299726 2:130201411-130201433 CACCATGTCCTCCCACGGGGAGG + Intergenic
939515458 2:143161902-143161924 CACCTAGATCACCCAAAGGATGG + Intronic
940319996 2:152366715-152366737 CACCTCGGCCTCCCAAAGTACGG - Intronic
940603098 2:155885610-155885632 CCCCTTGGCCTCCCAAAGTACGG - Intergenic
940939945 2:159548683-159548705 CACCTAGGCCTCCCAAAGCATGG - Intronic
942362359 2:175185342-175185364 CACCTTGACCTCCCAAAGTGCGG - Intergenic
943220101 2:185093078-185093100 CACCTTGGCCTCCCAAATGCTGG - Intergenic
945625428 2:212198830-212198852 CACCTCGGCCTCCCAAAGGCTGG + Intronic
946243773 2:218373481-218373503 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
946285766 2:218701386-218701408 CGCCTTGGCCTCCCAAAGTACGG + Intronic
946839555 2:223807015-223807037 CACCTTGGCCTCCCAAAGGGTGG - Intronic
947543113 2:230991907-230991929 CACCTTCACGTCACACAGGAGGG - Intergenic
947620164 2:231584904-231584926 CACCTTGGCCTCCCACATGCTGG + Intergenic
947730912 2:232431179-232431201 CACCTTGGCCTCCCAAAGGCGGG - Intergenic
947768795 2:232654714-232654736 CACCGTGCCCTGCCAGAGGATGG + Intronic
947834732 2:233167120-233167142 CACCTTGGCCTCCCAAAGTGTGG - Intronic
948444745 2:238023753-238023775 CTCCAGGACCTCCCACAGAAAGG - Intronic
1169010831 20:2248903-2248925 CACCTTGGCCTCCCAGAGTGTGG + Intergenic
1169280594 20:4263734-4263756 CACCTTGGCCTCCCAAAGTATGG + Intergenic
1169377776 20:5080788-5080810 CACCTTGGCCTCCCAAAGCTGGG + Intronic
1169461428 20:5798933-5798955 CACCTTGGCCTTCCAAAGTATGG - Intronic
1170648737 20:18219891-18219913 CACCTTGACCTCGCAAAGTGGGG - Intergenic
1170674627 20:18467502-18467524 CACCTTCACCTCCGCCATGAGGG - Exonic
1171175945 20:23050732-23050754 CACCCTGCCCATCCACAGGACGG - Intergenic
1171940106 20:31319979-31320001 CACCTTGCCCTCCCAAAGTGTGG + Intergenic
1172135936 20:32686738-32686760 CGCCTTGACCTCCCAAAGTGCGG + Intergenic
1172536249 20:35675626-35675648 CGCCTTGACCTCCCACAGTTGGG - Intronic
1172953475 20:38738119-38738141 CACCTCAACCTCCCAAAGTATGG + Intergenic
1173113040 20:40213348-40213370 CACCTTGGCCTCCCAAAGCGTGG - Intergenic
1173533870 20:43793735-43793757 CACCTTGGCCTCCGAAAGGGTGG + Intergenic
1173651137 20:44665142-44665164 CACCTTGGCCTCCCAAAATACGG - Intergenic
1174377817 20:50138241-50138263 CATCCTGACCTTCCAGAGGAGGG + Intronic
1174525004 20:51163581-51163603 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1174600506 20:51720583-51720605 CACCTTGACCTCCCAAAGCTGGG - Intronic
1174800513 20:53559633-53559655 CACCTTGACCTCCCAAATGCTGG - Intergenic
1175346486 20:58281094-58281116 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175510577 20:59521846-59521868 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175789163 20:61730969-61730991 CCCCTGGAGCTGCCACAGGAAGG - Intronic
1176158328 20:63634843-63634865 CACCTCGGCCTCCCAAAGGTGGG + Intergenic
1177588423 21:23129175-23129197 CGCCTTGACCTCCCAAAGCGTGG + Intergenic
1177859530 21:26436673-26436695 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1177963836 21:27702653-27702675 CACCTTGACCTGCCAAAGTGTGG - Intergenic
1178403705 21:32308122-32308144 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1178625172 21:34210283-34210305 CACCTTGGCTTCCCAAAGGCTGG + Intergenic
1178664940 21:34538392-34538414 CACTGTGTCCTCCCTCAGGATGG - Intronic
1179020336 21:37635003-37635025 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1180218339 21:46341129-46341151 CACCTTGGCCTCCCAAAGTGAGG + Intronic
1180687056 22:17677481-17677503 CACCTTGGCCTCCCTCACGCTGG - Intronic
1181023623 22:20115867-20115889 CACAATGACATCCCAAAGGAGGG - Intronic
1181639709 22:24190146-24190168 CACATTCACCTCCTCCAGGAAGG - Intergenic
1181842914 22:25680216-25680238 TGCCTTGACCTCCCACTGTATGG + Intronic
1181848872 22:25735574-25735596 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1182725068 22:32438638-32438660 CACCTTGGCCTCCCAAAGTACGG + Intronic
1182940630 22:34273244-34273266 CACCTTGACCTCCCAAAGTGTGG - Intergenic
1183307125 22:37088546-37088568 AGCCTGGTCCTCCCACAGGATGG - Intronic
1183963167 22:41424994-41425016 CACCTTGGCCTCCCAAAGTACGG + Intergenic
1183986224 22:41572034-41572056 CACCTTCCCCTTCCACAGGGAGG + Exonic
1184107432 22:42376289-42376311 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1184241598 22:43213998-43214020 CACCTGGGCCTTCGACAGGAGGG + Intronic
1184715139 22:46277721-46277743 GACCTGGAGCTCCCACAGGCTGG - Intronic
1185157676 22:49204116-49204138 GGCCTTCACCTCCCACAGGAGGG - Intergenic
950604156 3:14063615-14063637 CACCTTGGCCTCCCAAAGTGTGG + Intronic
950668309 3:14510511-14510533 CACCTTGGCCTCCCAAAGTGAGG + Intronic
951451063 3:22838872-22838894 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
951553212 3:23895884-23895906 CACCTCCACCTCCCAAAGTACGG - Intronic
951888043 3:27543184-27543206 CACCTTGGCCTCCCAAATGGTGG + Intergenic
952824062 3:37510251-37510273 CACCTTGGCCTCCCAGAGTGCGG + Intronic
953678219 3:45019836-45019858 CACCTCGGCCTCCCAAAGGCTGG - Intronic
953962844 3:47280455-47280477 CACATTGGCCTCCCAAAGGCTGG - Intronic
954257339 3:49415940-49415962 CACCTTGTCCCCTCATAGGATGG + Exonic
954264842 3:49464026-49464048 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
954893370 3:53953536-53953558 CACCTCGGCCTCCCAAAGGCTGG + Intergenic
955081692 3:55663614-55663636 CAACTTGCCCTCCGAAAGGAAGG - Intronic
955217581 3:56997231-56997253 CCTCATGACCTCCCTCAGGATGG + Intronic
955229030 3:57082927-57082949 CACCTTGGCCTCCCAAAGCGGGG + Intergenic
955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG + Intronic
955675834 3:61448189-61448211 CGCCTTGGCCTCCCAAAGGCTGG + Intergenic
955864854 3:63371870-63371892 CACCCTAACCACCCTCAGGATGG + Intronic
956672908 3:71708120-71708142 CACCTTGGCCTCCCAAAGTGCGG + Intronic
957969650 3:87366536-87366558 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
958500075 3:94894192-94894214 CTCCTTGGCCTCCCAAAGGCTGG + Intergenic
959059227 3:101601037-101601059 ACCCTTGGCCTCCCACAGTAAGG + Intergenic
959817355 3:110690403-110690425 CACCTTGGCCTCCCAAATGCTGG - Intergenic
960884001 3:122375913-122375935 CACCTTGGCCTCCCAAAGTCAGG - Intronic
961087828 3:124084310-124084332 CACCATGACCTGTCACAGGGAGG - Intronic
961159279 3:124708364-124708386 CACCTTTACCTTACAGAGGATGG - Intronic
962545355 3:136428884-136428906 CACCTTGGCATCCCACAGTGCGG - Intronic
962732943 3:138299811-138299833 CACCAGGACCTCCCAAAGCAGGG - Intronic
964048302 3:152358856-152358878 CACCTTGGCCTCCCAAAGTGCGG + Intronic
964381455 3:156102200-156102222 CACCTTGGCCTCCCAAAGTACGG + Intronic
964399847 3:156287581-156287603 CACCTCGGCCTCCCACAGTACGG - Intronic
965801968 3:172503969-172503991 CACCTTGACCTCCCAAAGTGTGG - Intergenic
966143217 3:176780277-176780299 CACCTTGACATCCAGGAGGATGG - Intergenic
966761764 3:183425603-183425625 CACCTTGAGGTCCCCCAGTAGGG + Intronic
966846879 3:184137609-184137631 CACTTTGACTTCCTAAAGGAAGG - Exonic
968270856 3:197402628-197402650 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
968462081 4:731257-731279 GACCTTGGACTCTCACAGGAGGG - Intronic
968564582 4:1304380-1304402 CACCTTAGCCTCCCAAAGCACGG + Intronic
969176812 4:5405112-5405134 CACCTTGGCCTCCCAAAGTGGGG + Intronic
969217330 4:5732759-5732781 CACCTTGGCCTCCCAAATGTTGG - Intronic
970423518 4:15926429-15926451 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
971392047 4:26195118-26195140 CACCTTGACCTCCCAGTGTTGGG - Intronic
971731931 4:30395430-30395452 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
971816199 4:31493185-31493207 CACCTTGGCCTCCCAAAGTTTGG - Intergenic
971818366 4:31519671-31519693 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
971910385 4:32788693-32788715 CACCTTGGCCTCCCAAAGCTTGG - Intergenic
972446308 4:39147471-39147493 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
972467701 4:39372893-39372915 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
973815098 4:54612230-54612252 CACCTTGACCTCCCAAATGCAGG + Intergenic
973855674 4:55008161-55008183 CACCTTGGCCTCCCAAAAGCTGG + Intergenic
974419520 4:61654648-61654670 CACCTTGGCCTCCCAAAGTGCGG - Intronic
974769646 4:66395502-66395524 CACCTTGGCCTCCCAAAGTGAGG - Intergenic
975336279 4:73179712-73179734 CACTTTGGCCTCCCAAAGGACGG + Intronic
975346319 4:73296262-73296284 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
975530977 4:75399115-75399137 CACCTTGGCCTCCCAAATGCTGG - Intergenic
975721270 4:77250867-77250889 CACCTTGACCTACAACAGCATGG - Intronic
975724496 4:77278851-77278873 CACCTTGACCTACAACAGCATGG - Intronic
976570262 4:86599007-86599029 CTCCTTGGCCTCCCAAAGCACGG + Intronic
978423984 4:108563027-108563049 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
978706192 4:111714877-111714899 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG + Intergenic
979232935 4:118366918-118366940 CACCTTGGCCTCCCAAATGTTGG + Intergenic
979246720 4:118515091-118515113 CATCAAAACCTCCCACAGGAAGG + Intergenic
980545469 4:134255861-134255883 CACCTTGTCCTCCCAAAGTGAGG + Intergenic
980994817 4:139770178-139770200 CGCCTTGGCCTCCCAAAGTACGG + Intronic
981958633 4:150508535-150508557 CACCTTGGCCTCCCAAAGTGTGG + Intronic
982556484 4:156872879-156872901 CACCTTGGCCTCCCAAGGGGTGG - Intronic
982802407 4:159721576-159721598 CACCTTGTCCTCCCAAAGTGCGG + Intergenic
984788191 4:183588867-183588889 CACCTTGGCCTCCCAATGGGTGG - Intergenic
985101602 4:186463684-186463706 CGCCTTGGCCTCCCAAAGGCTGG - Intronic
985512116 5:318794-318816 CACCTTTGCCTCCCACAGGCAGG - Intronic
985520507 5:372053-372075 CACCTTCTCCCCTCACAGGAAGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986642920 5:9889693-9889715 CTCCATGACCTCTCACATGAGGG - Intergenic
987387430 5:17343266-17343288 CACCTTGGCCTCCCAAAGCATGG - Intergenic
988144053 5:27281070-27281092 CACCTTGAATTCCCAAAGCAAGG + Intergenic
988408068 5:30849987-30850009 TACCTTGACCTCAAACAGCATGG + Intergenic
988526148 5:31988874-31988896 CACAGAGACCTCCTACAGGAGGG - Intronic
988812712 5:34801491-34801513 CACCTTGGCCTCCCAAAGTGTGG - Intronic
990878287 5:60511216-60511238 CACCTTGGCCTCCCAAAGTGAGG + Intronic
991301039 5:65129394-65129416 CACCTTGGCCTCCCAAAGTTTGG + Intergenic
992399336 5:76397384-76397406 CACCTTGGCCTCCCAAAGTCTGG + Intergenic
994248266 5:97506265-97506287 CACCTCGACCTCCCAAAGTGTGG - Intergenic
995239364 5:109868862-109868884 CAAACTGAACTCCCACAGGAAGG - Intronic
995659800 5:114468425-114468447 CAGCTTGCCCTCCAAAAGGAAGG - Intronic
996077647 5:119215845-119215867 CACCTTGGCCTCCCAAATGCTGG - Intronic
997225295 5:132205175-132205197 TACCCTGAGCTTCCACAGGATGG - Intronic
997317451 5:132949426-132949448 CACCTTGGCCTCCCAAAGTGCGG - Intronic
997483850 5:134211723-134211745 CGCCTTGGCCTCCCAAAGGCTGG + Intronic
997513199 5:134466812-134466834 CACCGGCACCTCCCACAGGCGGG - Intergenic
997535077 5:134614055-134614077 CACCTTGGCCTCCCAAAGTCTGG - Intronic
998795244 5:145811531-145811553 CACTTTGGCCTCCCAAAGTACGG + Intronic
999656504 5:153815830-153815852 CACCTTGGCATCCCAAAGTATGG - Intergenic
999764050 5:154724913-154724935 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1000284733 5:159817155-159817177 CACCTTGGCCTCCCAAAGGGGGG + Intergenic
1000336061 5:160242443-160242465 CGCCTTGGCCTCCCAAAGCAAGG - Intergenic
1000405167 5:160879588-160879610 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1000432009 5:161163444-161163466 CACCTTCACCTCCCAAATGCTGG + Intergenic
1000620166 5:163476062-163476084 CACCTTGGCATCCCAAAGTATGG - Intronic
1000776104 5:165422364-165422386 CACCTTGGCCTCCCAAATGCTGG - Intergenic
1000806759 5:165804815-165804837 TACCTTGACCTCTCAAAGCATGG + Intergenic
1001796528 5:174506725-174506747 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
1001897719 5:175396019-175396041 TACCTTGGCCTCCCAAAGTATGG + Intergenic
1002648893 5:180677189-180677211 CACCTCGACCTCCCAAAGTGTGG + Intergenic
1002958184 6:1888992-1889014 CAACTAGGCCTCCCAAAGGAGGG + Intronic
1003364694 6:5461286-5461308 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1004023890 6:11800046-11800068 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1004695446 6:18028811-18028833 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1004952058 6:20684191-20684213 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1005929564 6:30473590-30473612 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1006498461 6:34441206-34441228 CACCTTGGCCTCCCAAAGTACGG - Intergenic
1006650472 6:35547032-35547054 CACCTTGGCCTCCCAAATGTTGG + Intergenic
1007474727 6:42111671-42111693 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1007545802 6:42693541-42693563 CACATTTACCTGCCACAGCAAGG + Intergenic
1007678430 6:43617375-43617397 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1007735689 6:43980913-43980935 CATCTTGGCCTCCCAGAGTATGG - Intergenic
1007959456 6:45945721-45945743 CCTCCAGACCTCCCACAGGATGG - Intronic
1008954658 6:57201329-57201351 CATCTTGGCCTCCCAAAGGAAGG + Intronic
1009418172 6:63438162-63438184 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1012462974 6:99484548-99484570 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1012987238 6:105887843-105887865 CACCTAAACGTCCCACAGCAGGG + Intergenic
1013176436 6:107681302-107681324 CACCTTGGCCTCCCAAAGGCTGG + Intergenic
1013545093 6:111148857-111148879 CACCTCGGCCTCCCAAAGGCTGG - Intronic
1013565098 6:111350835-111350857 CACCTTGGCCTCCCAAAGATGGG + Intronic
1013778080 6:113701108-113701130 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1014138381 6:117913800-117913822 CACCTTGGCCTCCCAAATGCTGG - Intronic
1014239265 6:118996971-118996993 CACCTCGGCCTCCCACATGCTGG + Intronic
1015833286 6:137392236-137392258 CACCTTGGCCTCCCAAAGTATGG + Intergenic
1016355874 6:143217755-143217777 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1017115399 6:150971445-150971467 CATCTTGGCCTCCCAAAGTACGG + Intronic
1017434893 6:154406719-154406741 CACCTCGACCTCCCAAAGTGCGG - Intronic
1017463664 6:154674635-154674657 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1017494458 6:154971242-154971264 CACCTTGGCCTCCCAAATGCTGG + Intronic
1017505037 6:155060645-155060667 CACCTCGGCCTCCCAAAGTACGG - Intronic
1017760605 6:157565163-157565185 AACCTTGACCTCCCAGACGCAGG - Intronic
1018036334 6:159885325-159885347 CACCTCGACCTCCCACAGTATGG + Intergenic
1018231321 6:161678813-161678835 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1018887079 6:167948796-167948818 CACCATGAGCTCCCACAGGCAGG - Intronic
1019542261 7:1556755-1556777 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1019775298 7:2909072-2909094 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1020027876 7:4911894-4911916 CACCTTGACCTCCCAAGTGCTGG + Intronic
1020068939 7:5212764-5212786 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1020145985 7:5643461-5643483 GACCTTGCGCTCACACAGGAAGG + Intronic
1020164609 7:5798039-5798061 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1020228590 7:6299437-6299459 CACCTTGACCTCCCAAGTGCTGG - Intergenic
1021073830 7:16275577-16275599 CACGTTGGCCTCCCAAAGGGCGG - Intronic
1021526815 7:21597298-21597320 CCTCTTGACCTCCCAGAGTAGGG - Intronic
1023039832 7:36162393-36162415 CACCTTGGCCTCCCAAAGTTGGG - Intronic
1023063367 7:36351145-36351167 CACCTTGGCCTCCCAAATGCTGG - Intronic
1023845526 7:44117946-44117968 CTCGCTGACCTCCCGCAGGATGG + Exonic
1024420943 7:49165845-49165867 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1024551116 7:50562916-50562938 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1025863169 7:65352906-65352928 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1026064746 7:67060322-67060344 CGCCTTGGCCTCCCAAAGGTGGG + Intronic
1026350684 7:69512682-69512704 CAACTTGACCTCCCAAAGTGTGG - Intergenic
1026713554 7:72766363-72766385 CGCCTTGGCCTCCCAAAGGTGGG - Intronic
1026718017 7:72806899-72806921 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1026763231 7:73142461-73142483 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1026855979 7:73755210-73755232 CACCTTGGCCTCCCAAAGTGTGG - Intergenic
1027039696 7:74952245-74952267 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1027083946 7:75250141-75250163 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1027151480 7:75737172-75737194 CACCTTGGCCTCCCAAAGTACGG + Intronic
1027392328 7:77717189-77717211 CTCCTTGACCTCCCAAAGTTGGG + Intronic
1027719903 7:81727289-81727311 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1028614382 7:92748950-92748972 CACCTCGGCCTCCCACATGCTGG - Intronic
1029268153 7:99358786-99358808 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1029369109 7:100136490-100136512 CGCCTTGGCCTCCCAAAGGTCGG + Intergenic
1029835521 7:103305505-103305527 CACCTTGACCTCCCAAAACTTGG + Intronic
1030307962 7:108038407-108038429 CACCTTGCCCTCCCAAAGTGCGG + Intronic
1032238794 7:130145411-130145433 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1032617268 7:133487458-133487480 CACCTTGGCCTCCCAAAGAGAGG - Intronic
1033039215 7:137903059-137903081 CACCTTGGCCTCCCAAAGCACGG + Intronic
1034146039 7:148872950-148872972 CACCTTGTCCTCCCAAAGCTGGG - Intronic
1037615756 8:20517688-20517710 CACCTTGACCTTGCTCAGGGAGG + Intergenic
1037765424 8:21769540-21769562 GACCCTGAGCTCCCACAGTAGGG + Intronic
1038836996 8:31136721-31136743 CACCTCAACCTCCCACAAGGAGG - Intronic
1039069473 8:33636454-33636476 CACCTTGGCCTCCCAAAGTGCGG - Intergenic
1039489419 8:37936394-37936416 AACCTTGACCTCCCAAAGGAGGG + Intronic
1039870098 8:41538945-41538967 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1039879593 8:41616375-41616397 AACCTTGACCTCCCACATTTAGG + Intronic
1039891067 8:41685861-41685883 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1040437797 8:47409778-47409800 CGTCTTGGCCTCCCAAAGGATGG - Intronic
1040656799 8:49519777-49519799 CACCCTGGCCTCCCACAGTGAGG + Intergenic
1041040563 8:53842680-53842702 CACCTTGAGCTACGCCAGGACGG - Intronic
1041720148 8:60968178-60968200 CACCTTGACCTCCCAAATTGCGG + Intergenic
1041747940 8:61229873-61229895 CACCTTGGCCTCCCAAAGAGTGG + Intronic
1041903652 8:63008714-63008736 CATCTAGTCCTCCCACAGGAAGG - Intergenic
1042129893 8:65578075-65578097 CACCTCGGCCTCCCAAAGGTTGG + Intergenic
1042549898 8:69985121-69985143 CACCTCGACCTCCCAAAGTGCGG + Intergenic
1043435888 8:80236169-80236191 CACCTTGGCCTCCCAAAGTGCGG + Intergenic
1045154352 8:99450464-99450486 CACCTTGGCCTCCCAAATGCTGG - Intronic
1045842467 8:106596195-106596217 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1047125588 8:121956216-121956238 CACCTCGGCCTCCCAAAGCACGG - Intergenic
1047598121 8:126399193-126399215 CACCTCGACCTCCCAAAGTGTGG - Intergenic
1048104887 8:131397164-131397186 CACCTTGGCCTCCCAGATGCTGG - Intergenic
1048267499 8:133000332-133000354 CCCCTTGCCCTCCCACAGGCTGG + Intronic
1048970333 8:139641756-139641778 CAGCTGGTCCTCCCCCAGGAGGG - Intronic
1049211032 8:141386470-141386492 CACCTTGATGGGCCACAGGATGG + Intergenic
1049437888 8:142596034-142596056 CACCTTTACATTCCCCAGGAGGG - Intergenic
1049559655 8:143303231-143303253 CACCTCGGCCTCCCAAAGGGCGG + Intergenic
1049842624 8:144783049-144783071 CGCCTTGGCCTCCCAAAGTATGG - Intronic
1050050231 9:1592384-1592406 CACGTCTACCTCCCCCAGGAAGG - Intergenic
1050510605 9:6390754-6390776 CATCTTGGCCTCCCAAAGGTGGG - Intergenic
1051417755 9:16860560-16860582 CAGTTTGAGCTCCCACAGGGTGG - Intronic
1053276841 9:36789547-36789569 CAACATGACCTCCAAAAGGATGG - Intergenic
1053316582 9:37057144-37057166 CACTTCGACCTCCCAAAGGGAGG + Intergenic
1054766121 9:69043969-69043991 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1055323411 9:75103977-75103999 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1055575777 9:77659200-77659222 CACCTTGGCCTCCCAAAGCGAGG - Intergenic
1056263261 9:84870600-84870622 CACCTTGGCCTCCCAAGGGAGGG + Intronic
1057641516 9:96827554-96827576 CACCCTGGCCTCCCAAAGTACGG + Intronic
1058680945 9:107439717-107439739 CACCTCGGCCTCCCAAAGGCTGG - Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1059207830 9:112483274-112483296 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1059485830 9:114626071-114626093 CGCCTTGACCTCCCAAAGTGCGG + Intronic
1059530061 9:115027339-115027361 CACCTTGGCCTCCCAAAGTGTGG - Intronic
1059627747 9:116085628-116085650 CACCTTGGCCTCCCAAAGTGTGG + Intergenic
1060254556 9:122015660-122015682 CACCTGGCGCTCCCACCGGACGG + Intronic
1060535332 9:124382008-124382030 TACCTTGGCCTCCCAAAGGCTGG - Intronic
1060610583 9:124960866-124960888 CACCTTGGCCTCCCAAAGTGGGG - Intronic
1060648267 9:125301316-125301338 CACCTTGGCCTCCCAAAGTCTGG + Intronic
1061005232 9:127925193-127925215 CACGTTGAGCTCCCGGAGGAAGG + Exonic
1061038802 9:128128010-128128032 CACCTTGACCGCCTAAAGGGCGG + Exonic
1061528019 9:131184277-131184299 CACCTTGGCCTCCCAAATGCTGG + Intronic
1185770935 X:2765097-2765119 CACCTTGGCCTCCCAAAGTGCGG - Intronic
1187007456 X:15246723-15246745 CACCTTGGCCTCCCAAAGTGTGG + Intronic
1190251717 X:48731932-48731954 CACCTTGGCCTCCCAAATGCTGG + Intergenic
1190532513 X:51394191-51394213 GGCCTTGGCCTCCCAAAGGAGGG - Intergenic
1191821492 X:65313898-65313920 CACCTTGGCCTCACAGAGCATGG - Intergenic
1194324736 X:92499890-92499912 GACCTTTACCTCCAAAAGGAAGG + Intronic
1195024906 X:100866927-100866949 CACCTCGGCCTCCCAAAGGCCGG - Intronic
1195419698 X:104660686-104660708 CACCTTGGCCTCCCAAATGCTGG - Intronic
1196349446 X:114708553-114708575 CATCTTGGCCTCCCAAAGTAGGG - Intronic
1197234435 X:124043397-124043419 CACCTTGGCCTCCCAAAGTGCGG + Intronic
1198128290 X:133669110-133669132 CACCCTGGCCTCCCAAAGTATGG - Intronic
1199572112 X:149276744-149276766 CAACTTGACTCCCCAAAGGAAGG + Intergenic
1199775370 X:151006381-151006403 CGCCTTGGCCTCCCAAAGTATGG - Intergenic
1200168325 X:154052706-154052728 CACCTCGGCCTCCCACAGTGCGG + Intronic
1200633470 Y:5619065-5619087 GACCTTTACCTCCAAAAGGAAGG + Intronic
1200711174 Y:6486302-6486324 GACATTTACATCCCACAGGAGGG + Intergenic
1200947025 Y:8852755-8852777 CGCCTTGGCCTCCCAAAGTAGGG + Intergenic
1201255469 Y:12103805-12103827 CATCTTGGCCTCCCAAAGCACGG + Intergenic
1201310055 Y:12588788-12588810 CACCTTGGACTCCCAAAGGCTGG + Intergenic
1202044579 Y:20725660-20725682 CACCTTGGCCTCTCAAAGTATGG - Intergenic