ID: 1118900238

View in Genome Browser
Species Human (GRCh38)
Location 14:69980216-69980238
Sequence CCAGGGGCGATGCAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118900226_1118900238 12 Left 1118900226 14:69980181-69980203 CCAGAGCCAAAAGAGGGTAGAGG 0: 1
1: 0
2: 1
3: 25
4: 289
Right 1118900238 14:69980216-69980238 CCAGGGGCGATGCAGGAAATGGG 0: 1
1: 0
2: 0
3: 19
4: 137
1118900228_1118900238 6 Left 1118900228 14:69980187-69980209 CCAAAAGAGGGTAGAGGAGCCTG 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1118900238 14:69980216-69980238 CCAGGGGCGATGCAGGAAATGGG 0: 1
1: 0
2: 0
3: 19
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118900238 Original CRISPR CCAGGGGCGATGCAGGAAAT GGG Intronic
900598432 1:3493029-3493051 CCTGGGGCGGGGCAGGAACTCGG - Intronic
900882167 1:5390105-5390127 CGGGGGGCGGGGCAGGAAATAGG - Intergenic
904481805 1:30798637-30798659 CCTGGGGCCAGGCAGGAACTGGG - Intergenic
905865496 1:41374200-41374222 CCAGGAGGGAAGGAGGAAATGGG + Intronic
906181246 1:43821518-43821540 CCAGGGGAGAAGTAGGAAATTGG + Intronic
907804848 1:57808094-57808116 CCTTGAGCAATGCAGGAAATAGG - Intronic
909539911 1:76779739-76779761 CAAGGGGCCCTGCAGGAAACTGG + Intergenic
909728946 1:78871013-78871035 CTAGTGGAGCTGCAGGAAATGGG - Intergenic
910135154 1:83959306-83959328 CCAGGGCAGATCCAGGAAAGTGG + Intronic
915091250 1:153428053-153428075 GCAGGGGCTGTGCAGGAAATCGG + Intergenic
915093861 1:153445236-153445258 GCAGGGGCTGTGCAGGAAATTGG - Intergenic
915348532 1:155210453-155210475 CAAGGGGAGAAGCAAGAAATAGG + Intronic
916022177 1:160802307-160802329 GCAGGGGACATCCAGGAAATGGG - Intronic
917708679 1:177660735-177660757 CCAGGGGAGAGGCAGTAAAAAGG + Intergenic
920241353 1:204553392-204553414 CCAGGTGGGATGCAGAAAAATGG - Exonic
921410615 1:214832601-214832623 CCAGGGGAGAAGCATGGAATGGG - Intergenic
923548340 1:234941239-234941261 CTAGGAGAGAGGCAGGAAATGGG - Intergenic
924329756 1:242929674-242929696 CCACGGGCAATTCAGGAAGTAGG - Intergenic
1067234371 10:44435896-44435918 CCAGGGCCTCTGCAGGGAATTGG - Intergenic
1070891173 10:79943011-79943033 CCAGTGGTGATCCAGGAAATGGG + Intronic
1075121208 10:119666258-119666280 CCAGGGGCCAGGCTGGAAGTGGG - Intronic
1075448683 10:122531917-122531939 CCAGGAGAGATGAAGGAAAGGGG + Intergenic
1075652181 10:124134733-124134755 CCTGGTGCCATGCTGGAAATGGG + Intergenic
1075860128 10:125667920-125667942 CCAGGGTCAATGCTGGATATCGG + Intronic
1076248913 10:128969074-128969096 GGAGGGGCGGTGCAGGAAAGTGG + Intergenic
1076794800 10:132793309-132793331 CCAGGGGCCATGCAGGACCCGGG - Intergenic
1076819149 10:132930190-132930212 CCAGAGGCCATGCAGGGAAGAGG + Intronic
1078510681 11:11982038-11982060 CCGGGGGCAATGCTGGGAATGGG - Intronic
1079359246 11:19756876-19756898 CCAGGGGCAATTCAGGAAAGGGG - Intronic
1080455649 11:32416411-32416433 CCTGGGGCAATGCAGGAGTTAGG - Intronic
1080642042 11:34163880-34163902 CCATGGGGGATGCAGGCACTGGG + Intronic
1080823291 11:35826940-35826962 CCAGTGGGGTTGAAGGAAATGGG + Intergenic
1081844467 11:46229376-46229398 CCAGGGGCTGTGGAGGGAATGGG + Intergenic
1081856509 11:46307686-46307708 CCAGGGGGCAGGCAGGAAAGAGG - Intronic
1083408903 11:62478243-62478265 CCAGGGGCTAAGCAGGAGCTGGG + Intronic
1089698388 11:120229403-120229425 CCAGGGGAGATGCAGGAGGGAGG - Exonic
1089745041 11:120610721-120610743 GAAGGGAGGATGCAGGAAATAGG + Intronic
1092125946 12:6075164-6075186 GCAGGAGCCATTCAGGAAATGGG + Intronic
1094376746 12:29798187-29798209 CCAGGGGCTAGGCAGGAGAGAGG + Intergenic
1096614168 12:52822308-52822330 CCAGGGGTGGAGCAGGAAGTGGG + Intronic
1103724276 12:122990009-122990031 CCAGGGGCCAGGCAGGACACTGG + Intronic
1104972209 12:132536974-132536996 CCAGGGGCTCTGCAGGCACTCGG + Intronic
1106483572 13:30154632-30154654 ACGGGGGAGATGCAGGGAATGGG - Intergenic
1107052344 13:36064681-36064703 TCAGGGGAAAAGCAGGAAATGGG + Intronic
1109830296 13:67777432-67777454 CCAGAGGCTAGACAGGAAATGGG + Intergenic
1112461725 13:99608465-99608487 CCAGGGGCAGCGGAGGAAATGGG - Intronic
1112856626 13:103778552-103778574 GCAGTGGCGAGGCTGGAAATAGG - Intergenic
1112881160 13:104108023-104108045 CCAGTGGGGACTCAGGAAATGGG - Intergenic
1113414479 13:110117617-110117639 CCAGGTGCCAAGCAGGAATTGGG + Intergenic
1114634343 14:24178929-24178951 ACTGGGGCGATGCAGTAAACAGG - Intronic
1116440976 14:44952381-44952403 GCAGTGGGGTTGCAGGAAATGGG + Intronic
1116625339 14:47255960-47255982 GAAGGGAAGATGCAGGAAATGGG - Intronic
1116633336 14:47360924-47360946 CCAGGGATGATGGGGGAAATGGG + Intronic
1117102923 14:52369022-52369044 CTATGGGAGATGAAGGAAATGGG + Intergenic
1118773683 14:68959707-68959729 CCAGGGGGGTTGAACGAAATGGG + Intronic
1118900238 14:69980216-69980238 CCAGGGGCGATGCAGGAAATGGG + Intronic
1119204115 14:72781492-72781514 CCAGGGTAGATGCTGGAAAAGGG - Intronic
1120182767 14:81362475-81362497 CCTAGGGAGATGCAGGGAATGGG + Intronic
1121450069 14:94001384-94001406 CCCAGGGCTATGCAGGAAAGGGG - Intergenic
1121528850 14:94638655-94638677 GCAGGGGAGAGGCAGGAAAGGGG - Intergenic
1121974457 14:98390080-98390102 CCAGGAGAGAGGCAGGGAATAGG - Intergenic
1124573551 15:30887316-30887338 CCATTGGCGAACCAGGAAATAGG - Intergenic
1126945723 15:53817434-53817456 CCAGTTGCTATGCAGGTAATGGG - Intergenic
1132389496 15:101428102-101428124 TGAGAGGGGATGCAGGAAATGGG - Intronic
1132685938 16:1162141-1162163 CCATGGGTGATGCAGGACATGGG + Intronic
1134838880 16:17384988-17385010 CCAGGCCCGATGCTGGGAATAGG - Intronic
1136373824 16:29853040-29853062 CAAGCGGCGATTCAGGAATTCGG - Intergenic
1136646619 16:31624665-31624687 ACAGGGGTGCTGCAGGATATGGG - Intergenic
1139312497 16:66039550-66039572 CCAGGGGAGATGCAGCACACAGG + Intergenic
1139484794 16:67249345-67249367 CAAGAAGCGATGCAGGAACTGGG - Intronic
1139647193 16:68339954-68339976 CCAGAGGAGATGCAGGTAAGAGG + Exonic
1140843746 16:78866751-78866773 CCACGGGCTATCCAGGGAATTGG + Intronic
1143331296 17:6137863-6137885 CCAGGTGCAATGTAGGAAACAGG + Intergenic
1147621318 17:41869683-41869705 CCAGCGGCGATTCAGGAACCTGG + Intronic
1150295844 17:64006955-64006977 CAAGGGGCGGGGCAGGCAATGGG + Intronic
1150388772 17:64779493-64779515 CCCGGGGAGCGGCAGGAAATGGG - Intergenic
1150556186 17:66256699-66256721 CAAGGGGCCAAGCAGGAATTTGG + Intergenic
1152934041 17:83125658-83125680 CCAGGGGTGTGGCAGGAAAAGGG - Intergenic
1153471442 18:5450875-5450897 TCAGGGGCGATTCAGGAGACTGG - Intronic
1155334435 18:24749892-24749914 GCAGGGGAGGTGCAGGAACTGGG + Intergenic
1157103207 18:44748665-44748687 CCAGGAGCAATGCAGGTAAAGGG + Intronic
1161026897 19:2041049-2041071 CCAGGGGTGCTGCAGGACTTGGG + Exonic
1163644537 19:18481114-18481136 CAAGTGGGGATGCAGGAAATTGG - Intronic
1168394723 19:56038301-56038323 CCAGGGGTGAGGAAGGAAGTTGG + Intronic
930546790 2:52777981-52778003 CCAGGTGCTATGCAGGATAAAGG + Intergenic
933718144 2:85377159-85377181 GCAGGGGCTATGCACCAAATGGG - Intronic
940331592 2:152480725-152480747 CCAAGGGCTATGCAGTAACTTGG + Intronic
946291355 2:218747829-218747851 CAAGGGGAAAGGCAGGAAATGGG + Intronic
946403795 2:219482548-219482570 CCAGGGGAGAGGCAGGAAACTGG - Intronic
946455162 2:219819585-219819607 CCATGGGCGATGCAGAAGATGGG - Intergenic
1171176405 20:23053230-23053252 CAAGGGGCTATGCTGGAATTTGG + Intergenic
1173531262 20:43771576-43771598 CCAGGGGCAGTGGAGGAAAGGGG - Intergenic
1173677556 20:44850381-44850403 CCAAGGGCGTTGTTGGAAATTGG + Intergenic
1173694286 20:44995141-44995163 CCAGAAGTGATTCAGGAAATTGG + Exonic
1176110872 20:63410158-63410180 CCAGTGGCGATGGAGGAGATGGG + Intronic
1176161128 20:63649345-63649367 TCAGGGGCGAGGCAGGGCATTGG + Intronic
1176897383 21:14397210-14397232 CTAGGGGTGATTCAGAAAATTGG + Intergenic
1180506848 22:16021067-16021089 CCATGAGCAATGCAGAAAATGGG + Intergenic
1181343958 22:22203551-22203573 CCAGGCGAGAAGCAGGACATGGG + Intergenic
1183030073 22:35097157-35097179 GGAGGGGGGAAGCAGGAAATGGG - Intergenic
1183467633 22:37987599-37987621 CCAGGGGCCATGCAGGAGTGAGG + Intronic
1184315961 22:43689468-43689490 CCAGGGGCTGAGAAGGAAATAGG + Intronic
1184733668 22:46385425-46385447 ACAGGCGGGATGCAGGAAGTTGG - Intronic
1203331807 22_KI270739v1_random:701-723 CCATGAGCGATGCAGAAAATGGG - Intergenic
950085401 3:10254095-10254117 CAAGTGGAGATGCAGGAAAGGGG - Intronic
953411522 3:42692980-42693002 CCAGGGGTGATGAGGGAGATAGG + Intronic
962024388 3:131531935-131531957 CCAGGGGCCATGCAAGAATGTGG - Intergenic
966199618 3:177348310-177348332 CAAGGGAGGAGGCAGGAAATGGG + Intergenic
967986335 3:195098117-195098139 GCTGGGGAGAGGCAGGAAATGGG + Intronic
973850667 4:54958387-54958409 GCAAGGGCGATGCCAGAAATAGG - Intergenic
975259841 4:72285495-72285517 ACAGGGGCGATGAGGGAAAGGGG - Intronic
982040981 4:151396242-151396264 CCAGAGGCTATGAGGGAAATGGG + Intergenic
984934953 4:184881903-184881925 CCATGGGCCTTGCAGGACATTGG + Intergenic
985368229 4:189256773-189256795 CCAGGGGCAATGGAAGAAAATGG - Intergenic
989486803 5:41999971-41999993 CCTGGGGAGATGAGGGAAATGGG - Intergenic
990785686 5:59416354-59416376 CCAGGGGCTATTCAGGATCTGGG + Intronic
991086842 5:62655671-62655693 GCATGGGCGATGCAGAAGATGGG + Intergenic
991944199 5:71883733-71883755 CCAGGGTCCAGGCAGGAAAGTGG + Intergenic
998376269 5:141692818-141692840 CCAGGGTCGCTGAAGGAAAGGGG - Intergenic
1001734623 5:173988661-173988683 CCAGGGGAGATGGAGGGAAGTGG - Intronic
1002006599 5:176238985-176239007 GCCGGGCCGATGCAGGAAAGCGG + Intronic
1002219779 5:177671651-177671673 GCCGGGCCGATGCAGGAAAGCGG - Intergenic
1002635562 5:180606366-180606388 CCAGGGGTGACGGAGGAGATGGG - Intronic
1006722930 6:36171393-36171415 CCAGAGACAATTCAGGAAATAGG - Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007958203 6:45935991-45936013 CCAGGGAGGATGGAGGAAATCGG - Intronic
1013955850 6:115839360-115839382 CCAGGGGCAAGGCAGGAACTTGG - Intergenic
1017073055 6:150593569-150593591 TAAGGGGCAATGCAGGAATTTGG - Intergenic
1019772918 7:2894990-2895012 CCAGGGGCAGTGCAGGAAGTGGG + Intergenic
1019893531 7:3965721-3965743 CCAGGGGTGCTGCAGAAAAGGGG + Intronic
1019923924 7:4180079-4180101 CCAGGGGTGGTGCGGGAAACTGG + Intronic
1020534543 7:9379204-9379226 CCATGTGTGAAGCAGGAAATGGG + Intergenic
1021684950 7:23176090-23176112 ACAGGGGCGTTGGGGGAAATAGG - Exonic
1023021214 7:36013334-36013356 CCAGAGGCTAAGAAGGAAATAGG - Intergenic
1026742909 7:72990235-72990257 CCACGGCCCAGGCAGGAAATGGG + Intergenic
1027029023 7:74874940-74874962 CCACGGCCCAGGCAGGAAATGGG + Intergenic
1027100826 7:75374843-75374865 CCACGGCCCAGGCAGGAAATGGG - Intergenic
1029976941 7:104843753-104843775 CCAGATGGGAAGCAGGAAATGGG + Intronic
1038894317 8:31764403-31764425 CCAGGGGCTAAGCAGGGAATGGG - Intronic
1042709075 8:71695157-71695179 ACAGGGGCGAGGGAGGGAATGGG - Intergenic
1045035147 8:98170729-98170751 CCAGGGGAGATGCGGGGAATTGG - Intergenic
1046940501 8:119926189-119926211 CCAGGGACCAGGTAGGAAATGGG - Intronic
1048251515 8:132869986-132870008 ACAGTGGCCCTGCAGGAAATAGG - Intronic
1048941788 8:139406238-139406260 TCAGGGAGGATGCAGGCAATGGG + Intergenic
1051114161 9:13674946-13674968 ACAGAGGCTATGCAGGAAATGGG + Intergenic
1051114279 9:13675955-13675977 ACAGAGGCTATGCAGGAAATGGG - Intergenic
1051701875 9:19833143-19833165 GCATGAGCGATGCAGAAAATGGG + Intergenic
1053484174 9:38439546-38439568 CCAGGGGAGGAGCAGGAAGTTGG + Intergenic
1058243910 9:102600900-102600922 GCATGAGCGATGCAGAAAATGGG - Intergenic
1060030998 9:120214683-120214705 CCAGGGCCCATTCAGGAAATTGG - Intergenic
1061752135 9:132786451-132786473 CCAGGGGAGAAGCAGGACACTGG - Intronic
1061909608 9:133715762-133715784 ACAGGGGCGGTGCAGGGCATAGG - Intronic
1062035724 9:134381730-134381752 CCAGGGCCGCTGAAGAAAATAGG - Intronic
1062248512 9:135582726-135582748 CCGGCGGCCATGCAGGCAATGGG + Intergenic
1186942069 X:14520635-14520657 CCAGGCTCCATGCAGGCAATTGG - Intergenic
1191050269 X:56183934-56183956 CCATGAGCGATGCAGAAGATGGG + Intergenic
1201227114 Y:11828800-11828822 CCACGGGCAATTCAGGAAGTAGG - Intergenic