ID: 1118902272

View in Genome Browser
Species Human (GRCh38)
Location 14:69996455-69996477
Sequence AGAATACAGCCCAAGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118902272_1118902274 0 Left 1118902272 14:69996455-69996477 CCTGTCTTCTTGGGCTGTATTCT 0: 1
1: 0
2: 2
3: 21
4: 220
Right 1118902274 14:69996478-69996500 CTGCATGTAGTAAAGTGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 128
1118902272_1118902273 -5 Left 1118902272 14:69996455-69996477 CCTGTCTTCTTGGGCTGTATTCT 0: 1
1: 0
2: 2
3: 21
4: 220
Right 1118902273 14:69996473-69996495 ATTCTCTGCATGTAGTAAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118902272 Original CRISPR AGAATACAGCCCAAGAAGAC AGG (reversed) Intronic
901440549 1:9275426-9275448 AGCATACGGCCCAGGAAGACGGG - Intergenic
903725030 1:25435225-25435247 AGAATCCAGTACATGAAGACAGG - Intronic
904311036 1:29629793-29629815 AGAATAGAACCCAGGGAGACAGG + Intergenic
905134218 1:35785934-35785956 AAAATACAACCTAAGAAGAGAGG + Intergenic
905563832 1:38947706-38947728 CGAATTCGGCACAAGAAGACTGG + Intergenic
906645029 1:47468758-47468780 AGAGAACTGCCCAAGAAGATGGG + Intergenic
906741651 1:48190710-48190732 AGAATACACACCGAGAAAACAGG + Intergenic
907245374 1:53105293-53105315 AGAAAACAGGCTAAGAAGATAGG + Intronic
908867646 1:68569272-68569294 GCATTTCAGCCCAAGAAGACAGG - Intergenic
909033847 1:70574285-70574307 AAAATTCAGCCCAAGGAGTCAGG - Intergenic
909940312 1:81603661-81603683 GGAATACAGCTCAGGAAGAAAGG + Intronic
911863430 1:102985759-102985781 ATGATAGAGCCTAAGAAGACAGG + Intronic
912742038 1:112207268-112207290 AGAACAAAGCTCAAGAATACTGG + Intergenic
913968215 1:143394250-143394272 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
914062594 1:144219842-144219864 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
914116556 1:144746512-144746534 AGAAACCAGCCCAAGAAGAAAGG - Intergenic
915848033 1:159289536-159289558 AGGCTACTGCCCAAGAAGAATGG - Intergenic
917981104 1:180269960-180269982 AGAAAACAGCCCGAGGAGAAGGG + Intronic
918084871 1:181237042-181237064 AGAGCACAGGCCAAGAAGAGAGG + Intergenic
919328752 1:196142168-196142190 AGATTATAGGCCAAGAAGGCAGG - Intergenic
920544304 1:206802764-206802786 AGAGGACAGAGCAAGAAGACAGG - Intronic
921306082 1:213798380-213798402 AGAGTACAGACCAAGCAGATGGG - Intergenic
924389792 1:243541395-243541417 AGAAAACAGCCCAAGCTGAAGGG - Intronic
924562135 1:245165664-245165686 AGAAGACAGACCAAGAAGGAGGG + Intronic
1064729245 10:18312760-18312782 AAAATACAGGCAAAGGAGACAGG - Intronic
1065740479 10:28792538-28792560 AGAAAACAGCCCAGGACGGCTGG + Intergenic
1068334319 10:55612428-55612450 AGAATACGTCATAAGAAGACAGG + Intronic
1068476199 10:57529430-57529452 TAAATACAGCCCAAGATGACAGG - Intergenic
1068839761 10:61597692-61597714 AGAATACAGAACAAAAAGATGGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070951168 10:80432142-80432164 ACAATACATCCCATGAACACAGG - Exonic
1071374715 10:84990844-84990866 AGAATCCAGCCCCAGCAGAGGGG + Intergenic
1072981042 10:100097761-100097783 AGCATAGAGCCCAAGAAGCATGG - Intergenic
1073865909 10:107803458-107803480 AGAAAACAGCCCCAGAAAATAGG + Intergenic
1074032473 10:109702488-109702510 AGACTACAGCACAAGAGGATGGG - Intergenic
1074529419 10:114287026-114287048 AGAATGCATCCCAAGTAGACAGG - Intronic
1076253371 10:129000341-129000363 AGAATTCAACCCATGAAGTCAGG - Intergenic
1076310822 10:129506342-129506364 AGAATCCTGCCCAAGAGGATGGG - Intronic
1079291354 11:19191035-19191057 AGAATACAGGCCTAGAAGGCTGG + Intronic
1079387004 11:19989349-19989371 AGGCTACAGCCCAAGAATGCAGG + Intronic
1082853680 11:57787679-57787701 AGAACACAACTCAAGAAGACTGG - Intronic
1082989302 11:59193712-59193734 AGAAAAGGGCCCAAGAAGAAAGG + Intronic
1083389105 11:62335003-62335025 AGAATACTACCCACAAAGACAGG + Intergenic
1085449666 11:76624212-76624234 AGAATCAAGCCCAAGAGGCCTGG - Intergenic
1087166057 11:95003816-95003838 AGTATACAGTTCAAGAAGTCTGG + Intergenic
1089345001 11:117785406-117785428 AGAAGACAGCCCAACAACAGTGG + Intronic
1092450847 12:8600657-8600679 TCCATAAAGCCCAAGAAGACAGG - Intergenic
1092749062 12:11701587-11701609 AGAATACCACTCAGGAAGACAGG - Intronic
1093187462 12:16037726-16037748 AAAATCAAGCCCAAGCAGACAGG + Intergenic
1097055182 12:56244836-56244858 AGTATACTGCCCAAGCAGAAAGG + Intronic
1097459151 12:59838820-59838842 AGATCACAGCCCAGGAACACAGG - Intergenic
1098161771 12:67652543-67652565 AGAATTGAGTCCAAAAAGACTGG - Intronic
1099996969 12:89788461-89788483 AGAATTAAGCCCAAGACTACAGG - Intergenic
1100110632 12:91237705-91237727 AGAAAACAGGATAAGAAGACAGG + Intergenic
1100781304 12:98029553-98029575 AGAATAAAGGCACAGAAGACAGG + Intergenic
1104359434 12:128118081-128118103 AGTACACAGCCCAAGAGGCCCGG + Intergenic
1106530102 13:30582685-30582707 AAATTACAGTCCAAGAAGAAGGG + Intronic
1109670692 13:65602947-65602969 AGTATATAGCCCAAGTAGAATGG + Intergenic
1110399281 13:75070831-75070853 AGAAGACAGCAGAGGAAGACTGG + Intergenic
1110495169 13:76159967-76159989 AGAATGCAGACCAAGAATTCTGG - Intergenic
1110867758 13:80416758-80416780 AGTTTACAGCCCAGGGAGACAGG - Intergenic
1111247500 13:85559603-85559625 AGAATAAAGACCATGTAGACAGG - Intergenic
1111568053 13:90042441-90042463 ACACAACAGCCCAAGCAGACTGG + Intergenic
1112453885 13:99539815-99539837 AGAAAACAGGCCTAGAGGACGGG + Intronic
1112578008 13:100654055-100654077 AGAACAGATCCCACGAAGACGGG + Intronic
1113395815 13:109946554-109946576 AGAAGAGATACCAAGAAGACTGG + Intergenic
1114031317 14:18583411-18583433 TGAAAACAGCCTAAGAAGAGGGG + Intergenic
1114780126 14:25529811-25529833 AAAATACAGGCCAGGAATACAGG - Intergenic
1115498901 14:34032220-34032242 AAAAGACAGCCCAATGAGACAGG + Intronic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1119884457 14:78128844-78128866 ACAACACAGCCCAAGCAGAGTGG - Intergenic
1119897850 14:78235424-78235446 GGCAGACAGACCAAGAAGACTGG - Intergenic
1122734442 14:103828717-103828739 AGATTATGTCCCAAGAAGACAGG + Intronic
1122874169 14:104655698-104655720 AGAATACAGCTCAGAAAGAGGGG + Intergenic
1124416917 15:29479911-29479933 AGAACAGAGCCCAGGAAGAAAGG + Intronic
1126596889 15:50392058-50392080 AAAAAAAAACCCAAGAAGACAGG + Intergenic
1129172215 15:73815116-73815138 GGAATACAGCCCAGGAAGAGGGG + Intergenic
1130423071 15:83767656-83767678 ACCATGCAGCCCAAGAATACAGG + Intronic
1132076982 15:98830162-98830184 AGAAGACAGTCCAGGTAGACAGG - Intronic
1133329979 16:4966891-4966913 AGAATACAGCCCAAGCCTGCAGG + Intronic
1134124941 16:11610123-11610145 ATAATCCAGCCCAGGAGGACTGG + Intronic
1135398228 16:22147399-22147421 AGCATCAAGCCCAAGAAGACAGG + Intronic
1138380677 16:56599878-56599900 AGAAGACAGTCCCAGAAGACTGG - Intergenic
1139319019 16:66097830-66097852 AAAATACAGCTAGAGAAGACTGG - Intergenic
1139372099 16:66475340-66475362 AAAAAGCAGCCCAAGAAGAAAGG + Intronic
1140858228 16:78996713-78996735 AGTAAACAGCCCATGAAAACAGG + Intronic
1141406911 16:83802702-83802724 GGAATCCAAGCCAAGAAGACTGG + Intergenic
1147348315 17:39820127-39820149 AAAAAATAGCCCAAGAAGGCTGG + Intronic
1149852010 17:60043296-60043318 GTAATACAGGCCAAGCAGACGGG - Exonic
1150502899 17:65668190-65668212 AGAATAGTGCCCAAGGAGGCCGG - Intronic
1150627391 17:66850144-66850166 AGAATGCAGGGCAGGAAGACAGG - Intronic
1151992000 17:77581220-77581242 AGAAGACAGCCAGAGAGGACCGG - Intergenic
1153292232 18:3512764-3512786 AGAAGAGAGCCCAAATAGACTGG - Intronic
1153677487 18:7468377-7468399 AGGACACACCCCAAGAAGGCCGG - Intergenic
1154302647 18:13207812-13207834 AGAATACAGCACATGAAAAATGG + Intergenic
1155014767 18:21822785-21822807 AGTATAAAGGCCAAAAAGACTGG - Intronic
1156163250 18:34385638-34385660 AGAAAATAACCCAAGAAGAATGG - Intergenic
1159312999 18:66734670-66734692 AGTATCCAGCCTAAGAAAACCGG + Intergenic
1159401080 18:67935104-67935126 TGAATAGAGACTAAGAAGACTGG - Intergenic
1160055620 18:75477084-75477106 AGAAAGCAGCCCAAGAAGACAGG - Intergenic
1165450873 19:35881770-35881792 AGAATTCAATCCAAGAAGCCTGG + Intergenic
1168299138 19:55393336-55393358 AGATTACAGCCTAAGGAGGCTGG - Intronic
1168363852 19:55767490-55767512 AGAATACAGCCCTCGCTGACTGG + Intergenic
1202702002 1_KI270712v1_random:171714-171736 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
928337337 2:30408895-30408917 AGAATCCAGCCTAGGAAGAAAGG - Intergenic
928941738 2:36733808-36733830 AGAAAACATCCTAAGAGGACAGG + Intronic
930215591 2:48693139-48693161 AGAATACTGAGCAAGAAGAGAGG + Intronic
933648443 2:84830701-84830723 TGAATACAGGGCATGAAGACAGG + Intronic
934172914 2:89555164-89555186 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
934283228 2:91629521-91629543 AGAAACCAGCCCAAGAAGAAAGG + Intergenic
935148801 2:100415615-100415637 ACAATAAAGCCCAAGCTGACTGG + Intronic
935703001 2:105829101-105829123 AGCATACAGGCCAAGCAGAAAGG - Intronic
938496885 2:131802383-131802405 TGAAAACAGCCTAAGAAGAGGGG - Intergenic
939786848 2:146525064-146525086 ATAATACTGCACAAGAAGAAAGG - Intergenic
943685768 2:190816386-190816408 AGAAAACAGGGCAGGAAGACAGG - Intergenic
944486353 2:200210513-200210535 AGAATACAGCCAAGGTAGACTGG + Intergenic
946700777 2:222411092-222411114 AAAATCCAGCCCATGGAGACTGG - Intergenic
1169745046 20:8935080-8935102 AGAAAACGGCCCAGGAAGGCTGG - Intronic
1172621611 20:36321304-36321326 AGAATAGGGAGCAAGAAGACGGG + Intronic
1179527587 21:41992902-41992924 AAAAAACAGCCCTAGATGACAGG - Exonic
1180455430 22:15510469-15510491 TGAAAACAGCCTAAGAAGAGGGG + Intergenic
1181897093 22:26119985-26120007 TGAAAACAGCCCAGGATGACTGG - Intergenic
1184846713 22:47092279-47092301 GGAATACAGCCCCAGAGCACAGG + Intronic
949254031 3:2023636-2023658 AGCATACAGGCAAAGAAGGCTGG - Intergenic
950024479 3:9810759-9810781 AGAAAACAGCGCAGGGAGACAGG - Intronic
950716726 3:14853073-14853095 TGGAAACAGCCCAAGAGGACTGG - Intronic
951962265 3:28340730-28340752 AGAATACAACCCAGGCAGTCTGG - Intronic
952917621 3:38261047-38261069 ACAAAAAAGCCCAAGAGGACAGG + Intergenic
955320116 3:57968378-57968400 AGAAAAAGGCCCAAGAGGACTGG + Intergenic
956741797 3:72281227-72281249 AAAATGCAGACCAAGAAGAAAGG + Intergenic
956811204 3:72865624-72865646 AGCATAAAACCCAAGAAAACAGG - Intergenic
957713071 3:83889246-83889268 AGAATACAGACCATGAAGATGGG - Intergenic
957777568 3:84773294-84773316 AGAAAACAGACAGAGAAGACTGG + Intergenic
959063116 3:101633608-101633630 TCAATACTGCCCAAGATGACTGG + Intergenic
960943464 3:122949814-122949836 TGAACTCAGCACAAGAAGACAGG + Intronic
962047786 3:131778736-131778758 AGAATACAGCCCAGGGGGATAGG + Intronic
965250942 3:166343104-166343126 AGAAGCCTTCCCAAGAAGACAGG + Intergenic
965356308 3:167677673-167677695 AACATACAGTACAAGAAGACTGG + Intergenic
966243913 3:177784826-177784848 AAAATAAAGCCCAAGAAAACAGG + Intergenic
966947174 3:184784964-184784986 AAAATACAGCTCAAGAGGCCTGG - Intergenic
967342419 3:188414087-188414109 AAAATACATCCCAAGAGGGCAGG - Intronic
967474324 3:189898391-189898413 AGAATAAAAACCAAGAAGAATGG + Intergenic
967534894 3:190590748-190590770 AGAATCAAACCCAGGAAGACTGG - Intronic
968865619 4:3209456-3209478 CGAATAGAGCCTAAGAAGGCAGG - Intronic
969858780 4:10019965-10019987 GGAATACAGGCCAAGTGGACAGG + Intronic
971412392 4:26387975-26387997 AGAACACAGCTCAAGAATACAGG + Intronic
972214019 4:36874288-36874310 AGAATGAGGCCCAAGAAGAAGGG - Intergenic
972504532 4:39707814-39707836 AGAACTCAGCTCAAGAAGGCTGG - Intronic
972946579 4:44264448-44264470 AGAAGGCAACCTAAGAAGACAGG + Intronic
973082176 4:46006917-46006939 AAAATTCAGCTCAAGAAGTCAGG - Intergenic
974152945 4:58033039-58033061 AGAATACAGGAAAAGAAGATTGG + Intergenic
975914287 4:79305072-79305094 AGAATTCAGCCCATGAAGACAGG - Intronic
978013328 4:103713820-103713842 GAAATACAGCCAAAGAAGAGAGG + Intronic
978724770 4:111957052-111957074 AGAATACAAGCCAGGATGACTGG + Intergenic
979721610 4:123906372-123906394 AAAATAGTGTCCAAGAAGACTGG + Intergenic
981496003 4:145393392-145393414 AGAATACAGCAGAAGGACACAGG + Intergenic
981531494 4:145758624-145758646 ACAATACACTCCAAGAATACTGG - Intronic
981562781 4:146065703-146065725 AGATTACATCCCAAAAAGGCTGG + Intergenic
981763186 4:148216495-148216517 AGATTTGAGCCCAAGCAGACAGG + Intronic
984923421 4:184785661-184785683 TGAGTACAGATCAAGAAGACTGG + Intronic
985551338 5:534984-535006 AACACACACCCCAAGAAGACAGG - Intergenic
986748889 5:10767425-10767447 AGACAACAGCACAAGAAGACAGG - Intergenic
986919201 5:12663200-12663222 AGAAAGCAGCCTGAGAAGACAGG - Intergenic
987023490 5:13899360-13899382 AGAATACAGACAGAGAAGAATGG - Intronic
987539542 5:19236385-19236407 AGACTACAGCCCATGTAGAGTGG + Intergenic
989520480 5:42395392-42395414 AGAATAGAACATAAGAAGACGGG + Intergenic
990538842 5:56751944-56751966 TGAATACAGACCAACAGGACAGG + Intergenic
990854930 5:60254175-60254197 GGACTACAGCCCAAGAACAAAGG - Intronic
991395671 5:66202641-66202663 ACTATACAGCCAAAAAAGACAGG - Intergenic
991628471 5:68629566-68629588 AGAATACATTCTAATAAGACAGG - Intergenic
992565829 5:77994504-77994526 AGAAAACAGCCAAAGGAGAGTGG + Intergenic
992694893 5:79276512-79276534 AGAATTGAGCCCAGGAGGACGGG - Intronic
995275661 5:110274903-110274925 AGAAGACATTCCCAGAAGACAGG - Intergenic
996676907 5:126186742-126186764 AGAGTAAAACCAAAGAAGACAGG + Intergenic
998118021 5:139553342-139553364 AGAGTACAGCCCAAGCAGTTTGG - Intronic
998882428 5:146657118-146657140 AGAGTAGAGCCCTAGAAAACAGG + Intronic
1001158403 5:169293015-169293037 CTAATACAGTCCAAGAAGATTGG + Intronic
1003293535 6:4803613-4803635 AGATTAGAGCCCACGCAGACAGG - Intronic
1003758077 6:9144922-9144944 AGAATTCATCACCAGAAGACTGG + Intergenic
1004043527 6:12006138-12006160 AGTCTACAAGCCAAGAAGACAGG + Intergenic
1004949670 6:20654474-20654496 AGAACACAGACCAAAAAGAACGG - Intronic
1006266256 6:32927083-32927105 AAAATACATCCAAAGAAGAAAGG + Intergenic
1007008583 6:38392466-38392488 GGAATACAGCCTAAGAAAAGGGG + Intronic
1007150998 6:39690740-39690762 AGGAGACAGCTCAAGAAGAGTGG + Intronic
1007841809 6:44722623-44722645 AGAATGCAGCCCAAGAGGGGAGG - Intergenic
1014191562 6:118502089-118502111 AGAATACTGCCCTATGAGACTGG + Intronic
1016946676 6:149540988-149541010 AGAATTAAGCACAAGAAGAAAGG - Exonic
1018012688 6:159686033-159686055 AGAAAACTGCCCATCAAGACAGG - Intronic
1019951587 7:4377518-4377540 AGAATACGGTCAAAGAAGCCAGG - Intergenic
1020141652 7:5615084-5615106 AGAAGACAGTCCAAGGAGACTGG - Intergenic
1020419148 7:7980647-7980669 AGAATTAAGCACAAGAAGAAGGG + Intronic
1022590076 7:31653181-31653203 AGGATACACACCCAGAAGACAGG + Intronic
1022835360 7:34108468-34108490 AGAATACTGCCCAGTAAGATTGG - Intronic
1023857656 7:44194601-44194623 GGATTACAGCCAAGGAAGACAGG - Intronic
1025966767 7:66280242-66280264 AGAAAACAGCCCAAGAATGCTGG - Intronic
1026546912 7:71331135-71331157 ATAACACTGCCCAAAAAGACAGG - Intronic
1026563584 7:71471014-71471036 AGAATGCAGGCTAAGAAGAAAGG - Intronic
1027722913 7:81768054-81768076 AGAATGCAGCCCAAGAGTGCTGG - Intronic
1027857082 7:83525840-83525862 AGTATACAACCCAAGATCACTGG - Intronic
1028192309 7:87867688-87867710 ACAATCCAGACCAAAAAGACTGG - Intronic
1029203443 7:98854399-98854421 TGAATACAGCCCCAAAAGGCAGG + Intronic
1030670874 7:112335344-112335366 AGAAGACAGGGCAAGAAGAGAGG + Intronic
1031746025 7:125499135-125499157 AGACTATAATCCAAGAAGACTGG + Intergenic
1033276459 7:139975374-139975396 AGAATACAGACTAAGGAGTCGGG - Intronic
1035347852 7:158217511-158217533 AGAAAACAGCACAAGAACTCTGG + Intronic
1035449459 7:158966523-158966545 AGAGTACATCCCCAGAAGAAGGG - Intergenic
1036789616 8:11709093-11709115 ACATCACAGCCCCAGAAGACCGG + Intronic
1040974544 8:53175529-53175551 AGACTACAGACAATGAAGACAGG + Intergenic
1041964289 8:63657066-63657088 ACAATAAAGACCAATAAGACAGG - Intergenic
1043519368 8:81027608-81027630 AGAATATAGGCCAAGAGGCCGGG + Intronic
1044245764 8:89943271-89943293 AGAATACAGAACTAGAAGAGTGG - Exonic
1048241306 8:132744112-132744134 ACCATAAGGCCCAAGAAGACAGG + Intronic
1048403956 8:134099358-134099380 AAAATACGGACTAAGAAGACTGG - Intergenic
1049606334 8:143530928-143530950 AGAAGACAGCCCCAGAAGGGTGG - Intronic
1050003170 9:1099982-1100004 AGAGTACAGGCCTTGAAGACAGG - Intergenic
1050476607 9:6047347-6047369 AGAAAGCAGCAGAAGAAGACCGG + Intergenic
1052025409 9:23568509-23568531 TGGTTTCAGCCCAAGAAGACAGG + Intergenic
1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG + Intronic
1055028112 9:71744076-71744098 AGAATATGGCACAAGAAGGCTGG + Intronic
1055898661 9:81209681-81209703 AGAATACATCACAAGAAAATTGG + Intergenic
1057141710 9:92730362-92730384 AGAATTCAGTCCAAGAAAATAGG + Intronic
1058131511 9:101259219-101259241 TGAAGGCAGCCCAAGAAGAGAGG + Intronic
1059002544 9:110365189-110365211 AAAATACAGCCAAAAAAGCCGGG - Intergenic
1059052043 9:110936857-110936879 AGAATACAGCCAAAAAGGAAAGG + Intronic
1059657965 9:116373604-116373626 AGATGAAGGCCCAAGAAGACAGG - Intronic
1060291995 9:122312144-122312166 AGAATACAGGCCAGAAAGATCGG + Intronic
1185474444 X:406079-406101 AGAATACAGTCCAGGAAGGAAGG - Intergenic
1185990572 X:4890443-4890465 TGAGTATAGCCCAAAAAGACTGG + Intergenic
1186147560 X:6640544-6640566 AGAAGACAGCAGAATAAGACAGG + Intergenic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1189974869 X:46450564-46450586 AGAAAACAGCCAGAGAAGAGGGG - Intronic
1189984471 X:46541963-46541985 AGAAAACAGCCAGAGAAGAGGGG + Intronic
1190444269 X:50507496-50507518 AGAATACAGGCAAAAAAGTCAGG + Intergenic
1191663919 X:63678339-63678361 AGTATACTGCCCAAGACCACAGG - Exonic
1192767565 X:74157821-74157843 AGAATTCATCACAACAAGACTGG + Intergenic
1195605137 X:106797928-106797950 AGAATATAGGGCAAGAATACAGG - Intergenic
1195699199 X:107689611-107689633 AGCTTAGAGCCCAAGAAGAGGGG + Intergenic
1196143815 X:112295336-112295358 AGCATACTGCCCTAGAAGCCAGG - Intergenic
1197322827 X:125053885-125053907 AGATTTCAGCCCAAGCAGTCTGG + Intergenic
1198650648 X:138860418-138860440 AGAATCCAGCCCATTAAGATAGG + Intronic
1199321940 X:146450145-146450167 AGCATACAGCATAAGAACACGGG - Intergenic
1201642946 Y:16198777-16198799 TCAATACTGCCCAAGATGACTGG + Intergenic
1201659869 Y:16386544-16386566 TCAATACTGCCCAAGATGACTGG - Intergenic
1201721355 Y:17101050-17101072 AGTTTACAGCCTAAGAAAACTGG + Intergenic