ID: 1118904055

View in Genome Browser
Species Human (GRCh38)
Location 14:70010665-70010687
Sequence TTGCTACTTACTTTGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118904051_1118904055 -10 Left 1118904051 14:70010652-70010674 CCAGGCCTGGTCCTTGCTACTTA 0: 1
1: 0
2: 1
3: 24
4: 288
Right 1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 95
1118904050_1118904055 -3 Left 1118904050 14:70010645-70010667 CCTGGGTCCAGGCCTGGTCCTTG 0: 1
1: 0
2: 3
3: 36
4: 356
Right 1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118904055 Original CRISPR TTGCTACTTACTTTGGATGC TGG Intronic
910524328 1:88160442-88160464 TTCCAACTTACTTTGGAAGAGGG + Intergenic
911172440 1:94783709-94783731 TCGCTATTTACTTTGGATGCTGG + Intergenic
911947104 1:104125707-104125729 TTGCCACTGGCATTGGATGCTGG + Intergenic
912722715 1:112033555-112033577 TTGTTTCTTATTCTGGATGCTGG - Intergenic
917939934 1:179908662-179908684 TATCTACTTACTTTGCATCCTGG - Exonic
918767216 1:188501568-188501590 TTTCTACTCACCTTGGATGCAGG + Intergenic
919027411 1:192194537-192194559 TTGCTACTTATTTTGATTTCAGG - Intergenic
919527888 1:198677598-198677620 TTCCTACTTTCTATGGAAGCAGG - Intronic
921654778 1:217721840-217721862 TTCCTACCTACTTGGGTTGCTGG - Intronic
1068113260 10:52706732-52706754 TTGCTTCTGACTTTGAATGATGG + Intergenic
1069025588 10:63537462-63537484 CTGCTTCTTAAGTTGGATGCCGG + Intronic
1072782934 10:98262381-98262403 CTGCTACCTCCTTTGGGTGCTGG + Intronic
1073778706 10:106813833-106813855 TCCCTACTTACATTGGAGGCTGG + Intronic
1073834840 10:107429391-107429413 CTGCTCCTTACTTGGGATTCAGG + Intergenic
1078407542 11:11083669-11083691 GTGCTTCTGACTTTGGATCCTGG + Intergenic
1087155226 11:94895362-94895384 TTGCTTATTACTTTGGAAGTAGG - Intergenic
1090616255 11:128518096-128518118 TTGCCAGTTACTTTGGGTGATGG - Intronic
1091002512 11:131922195-131922217 TTGCTACTCATTATGGCTGCTGG + Intronic
1092593838 12:9977579-9977601 TTCCTACTTATTTTGCATGCTGG + Intronic
1094087758 12:26612487-26612509 TTGCCACTATCTTTGGCTGCTGG + Intronic
1095533865 12:43223696-43223718 ATTCTACTTACATTGTATGCTGG - Intergenic
1106479142 13:30123807-30123829 TTGGGACTTGCTTTGGTTGCGGG + Intergenic
1110103851 13:71645058-71645080 TTCCAACTTGCTTTGGATTCTGG - Intronic
1117302381 14:54442294-54442316 TTGCTACTTGTTTTTAATGCTGG + Intergenic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1120807150 14:88765051-88765073 TTACTTTTTTCTTTGGATGCTGG - Intronic
1121769561 14:96521222-96521244 TTTCTAGTTAATTTGGAAGCAGG + Intronic
1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG + Intronic
1137618936 16:49863514-49863536 TTGCTAATTAGATTGGATGGTGG - Intergenic
1137856280 16:51797511-51797533 TTGCTCCTTATTTTGGCTTCAGG + Intergenic
1146717586 17:35099441-35099463 TTGCATCTTACTGTGGTTGCAGG + Intronic
1147017551 17:37504493-37504515 CTTCTACTTACTTTGGAGGAGGG - Intronic
1148291105 17:46450738-46450760 TTGCTAATTACATTGGATATAGG - Intergenic
1148313293 17:46668441-46668463 TTGCTAATTACATTGGATATAGG - Intronic
1149063235 17:52449104-52449126 TTGCTAATTAATTTATATGCAGG + Intergenic
1150197885 17:63319981-63320003 TTGCTTCTTATTATGGATGATGG + Intronic
1153379283 18:4418347-4418369 TTGCTGCTTACTTTGTCTGTTGG - Intronic
1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG + Intronic
1159714081 18:71799260-71799282 TTTCAACATACTTTGGATGCAGG + Intergenic
926019025 2:9478551-9478573 TTTCTACATACCTTGGTTGCTGG + Intronic
927383853 2:22510452-22510474 TTACTACATACCTAGGATGCAGG - Intergenic
928563634 2:32518855-32518877 CTGCTCCATACATTGGATGCTGG - Exonic
930477210 2:51897579-51897601 TTGCAAGTTACTCTGGATGATGG + Intergenic
931327417 2:61240966-61240988 TTGCTTCTTAGATTGGATGATGG - Intronic
931371758 2:61669596-61669618 TTTTTAGGTACTTTGGATGCAGG - Intergenic
935116385 2:100140428-100140450 TTACTACTTGCTTTGTATTCTGG + Intronic
936657350 2:114503780-114503802 CTATTACTTACTTTTGATGCTGG + Intronic
938395751 2:130946658-130946680 TTGCTATGTACTCTGGATCCTGG + Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940713353 2:157189370-157189392 TTGCTAATTAATATGGATGGAGG + Intergenic
943668376 2:190634206-190634228 TTGTTTCTTAATATGGATGCTGG - Intergenic
948513616 2:238489172-238489194 TTCCTATTTCCTGTGGATGCGGG - Intergenic
1172103090 20:32497461-32497483 TTGCTTTTTATTTTGAATGCGGG - Intronic
1172795547 20:37534783-37534805 TTGTGACTTATTTTGGAGGCAGG - Intergenic
1172795662 20:37535449-37535471 TTGTGACTTTCTTTGGAGGCAGG + Intergenic
1175580038 20:60091417-60091439 TAGCTGCTTACTTGGGAGGCTGG + Intergenic
1179285274 21:39972587-39972609 TTGCTACTGAGTCTTGATGCTGG + Intergenic
951824616 3:26854597-26854619 CTGCTTCTTAATTTGGGTGCTGG - Intergenic
951996631 3:28736796-28736818 TTGCCACTTCCTTTGGCTGGGGG + Intergenic
952048104 3:29348753-29348775 TTGCTACTTAAAGTGGATCCTGG - Intronic
953384161 3:42496432-42496454 CTGCAACTTGCTTTGGTTGCTGG + Intronic
954502111 3:51027984-51028006 TAGCTAGTTACTTTGTAGGCTGG + Intronic
955125495 3:56106885-56106907 TTTTTAATTACTTTGGCTGCTGG + Intronic
956738161 3:72255098-72255120 TTGCTACTTTCGCTGGATGGAGG - Intergenic
963772383 3:149401133-149401155 TTGCTACTTTTTCTGGATTCTGG - Intergenic
963842463 3:150121588-150121610 TTGCTTCTTGCTCTGGGTGCTGG + Intergenic
966031601 3:175355599-175355621 TTGCTACTTACTTTGAAATTAGG + Intronic
968496956 4:923851-923873 TTTCTGCTTACTCTGGATACAGG - Intronic
970396862 4:15677207-15677229 ATGTTTCTTAATTTGGATGCTGG + Intronic
977342718 4:95779579-95779601 TTTCTACCTACTTTAGAGGCAGG + Intergenic
977866424 4:102033800-102033822 TTGCTACTTATTTGGGATACAGG - Intronic
980471124 4:133253253-133253275 TTGATAATTACTTTGGCTACTGG + Intergenic
990380079 5:55214205-55214227 TTTCTTCCTACTTTGAATGCAGG + Intergenic
992908208 5:81369319-81369341 TTCCTGCTTGCTTTGGATTCAGG + Intronic
998617560 5:143757193-143757215 ATGCAAGTTACTTTGTATGCAGG - Intergenic
1000959438 5:167582133-167582155 TTACCACTTACTGTTGATGCAGG + Intronic
1007117131 6:39350724-39350746 TTGCCACTTGCTTTAGATGCTGG - Intronic
1008872511 6:56289413-56289435 TTGCTACTTATTATAGGTGCTGG - Intronic
1009528437 6:64778328-64778350 TTGCAGATTTCTTTGGATGCTGG - Intronic
1009793944 6:68441862-68441884 TGGCTTTTTACTTTGGCTGCAGG - Intergenic
1021332320 7:19354225-19354247 TTGCTACCTTCTTTGGTTTCAGG + Intergenic
1022870917 7:34478827-34478849 TTTCTAGTTACTTAGGAAGCTGG - Intergenic
1028525335 7:91778479-91778501 TTGCTACATACTTTACATACAGG - Intronic
1029877125 7:103765963-103765985 TTGCTACTGACTCTGGAGGTGGG - Intronic
1039318255 8:36397598-36397620 TTACTTCTTAATCTGGATGCTGG - Intergenic
1044386123 8:91590840-91590862 TAGCTACTGACTTTGGAGGGTGG + Intergenic
1046819241 8:118618486-118618508 GTGATATTTACTTAGGATGCAGG + Intronic
1048589238 8:135805846-135805868 TTTCTATTGCCTTTGGATGCAGG - Intergenic
1055491232 9:76807189-76807211 GTGCTAGCTACTTTGGAGGCTGG - Intronic
1057264579 9:93606089-93606111 CAGCTACTTACTTAGGAGGCTGG - Intronic
1057573698 9:96222626-96222648 TTGCTGCTGGCTGTGGATGCAGG - Intergenic
1058595788 9:106614111-106614133 TTGCTACTGCCTTTAGAAGCTGG + Intergenic
1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG + Intergenic
1186670425 X:11761885-11761907 TTTATATTAACTTTGGATGCAGG - Intronic
1188160957 X:26801902-26801924 TTTCTGCTTACTTTTCATGCTGG + Intergenic
1188364031 X:29292008-29292030 TAGCTACTTTCTCTGGATGATGG + Intronic
1189302484 X:39962124-39962146 TTGCTTCTTGATTTGAATGCTGG - Intergenic
1193326026 X:80179432-80179454 TTGCTACCTCCTTTGGGAGCTGG - Intergenic
1197657203 X:129129754-129129776 TTGCTAGGTACTTTTGATGAAGG - Intergenic
1197694349 X:129534992-129535014 TTGCTACTTTATTTCTATGCGGG - Intergenic
1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG + Intergenic
1200580692 Y:4946817-4946839 TTGCCACTTGCTTTGGGTGGTGG + Intergenic
1201566206 Y:15367580-15367602 TAGGTACTTGCTTTGGATGTTGG + Intergenic