ID: 1118904251

View in Genome Browser
Species Human (GRCh38)
Location 14:70011972-70011994
Sequence CTGGTGACACAGGACGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118904244_1118904251 29 Left 1118904244 14:70011920-70011942 CCTGAGCGATGTGGACAGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118904251 Original CRISPR CTGGTGACACAGGACGACCA TGG Intronic
900796312 1:4710832-4710854 CTGGTGTCACATGAAAACCAGGG - Intronic
902626059 1:17677014-17677036 CTGAGGACACAGCACGGCCAGGG - Intronic
902830321 1:19008211-19008233 TCGGTGACACAGGGCGGCCAGGG + Intergenic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
915589247 1:156861230-156861252 CTGGTCAGGCAGGACGAGCACGG + Intronic
916015987 1:160750328-160750350 CAGGAGACACAGGAGGACCATGG - Exonic
922769806 1:228175713-228175735 CTGGGGCCACAGGAAGTCCAGGG - Exonic
1063189245 10:3678512-3678534 CTGGTGACCCAGGACCACCCAGG + Intergenic
1074580492 10:114714372-114714394 CTGGTGACCCAGGAGTGCCATGG - Intergenic
1076424790 10:130359825-130359847 CTGGTGACGCAGGGAGCCCATGG + Intergenic
1076486850 10:130826241-130826263 CAGGTGACACAAGAAGGCCAGGG - Intergenic
1077326372 11:1965766-1965788 CTGGAGCCACAGAACGCCCATGG + Intronic
1083048123 11:59754862-59754884 CTGGAGATACAGGACGGTCAGGG - Intronic
1083177367 11:60959152-60959174 CGGGTGACACAGCAAGACCCTGG + Intergenic
1087618120 11:100511797-100511819 CTGGAGACCCAGGAAGGCCAGGG - Intergenic
1089601641 11:119619266-119619288 CTGGTGACACTGGCCAAACAAGG + Intergenic
1091221733 11:133933722-133933744 TTGGTGACACAGCAGGACCCTGG + Intronic
1202809353 11_KI270721v1_random:20945-20967 CTGGAGCCACAGAACGCCCATGG + Intergenic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1095946525 12:47756942-47756964 CTGGTGACAGAGGAAGACTCTGG + Intronic
1096799792 12:54102544-54102566 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1099298478 12:80861333-80861355 CTGGTGACACCGGACAGGCAAGG + Intronic
1099798354 12:87426085-87426107 CTGGTGACTAAGGATGACTAAGG - Intergenic
1104388955 12:128375246-128375268 CTGTTGTCACAGGAAGGCCACGG + Intronic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1114057491 14:18984922-18984944 CTGGTGACAGAGCAAGACCCTGG + Intronic
1114105053 14:19416825-19416847 CTGGTGACAGAGCAAGACCCTGG - Intronic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1122204586 14:100142225-100142247 CTGGGGGTACAGGAAGACCAAGG + Intronic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1128692196 15:69733233-69733255 CTGGTGAATAAGGACTACCATGG + Intergenic
1128861980 15:71081833-71081855 CTAGTGGCACAGGAGGAGCATGG + Intergenic
1129117183 15:73370931-73370953 CTGCTGCCACAGGCCGGCCAGGG + Intergenic
1129536317 15:76316136-76316158 CTGATGACAGAGGCCGACTAAGG + Intergenic
1133157185 16:3883373-3883395 ATGGTGAGACAGGAAGACTAGGG - Intergenic
1139909978 16:70391711-70391733 CTGGTGACACAGGCTGGCCGGGG + Intronic
1141797781 16:86286593-86286615 CCGGAGACGCAGGACGACCTCGG - Intergenic
1142938977 17:3365318-3365340 CTGGTGACCCAGGACTTCCAGGG + Intergenic
1144889023 17:18483418-18483440 CTGGGGACTCAGGAGGCCCAAGG - Intronic
1145143186 17:20460878-20460900 CTGGGGACTCAGGAGGCCCAAGG + Intronic
1145792692 17:27637805-27637827 CTGGAGACTCAGGAAGCCCAAGG - Intronic
1145807561 17:27745673-27745695 CTGGGGACTCAGGATGTCCAAGG - Intergenic
1146625854 17:34434976-34434998 GTGGTGACACAGGAAGTGCATGG - Intergenic
1151404500 17:73877875-73877897 ATGGAGACAAAGGATGACCAGGG - Intergenic
1151576711 17:74956065-74956087 CTGCAGAGCCAGGACGACCAAGG + Intronic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1153835320 18:8958945-8958967 CTGGTTACAAAGGAAGTCCATGG + Intergenic
1154455972 18:14525924-14525946 CTGGTGACAGAGCAAGACCCTGG - Intronic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1160834020 19:1116292-1116314 CTGGTGTCACAGGGCCACCTCGG + Intronic
1161356199 19:3820743-3820765 CAGGAGACACAGGAACACCAGGG + Intronic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1161753803 19:6116756-6116778 CTGTTGACATAGGACACCCAGGG + Intronic
1162280671 19:9695008-9695030 TAGGTGACACAGGACTACTATGG - Intronic
1165699264 19:37925225-37925247 GTGGTCCCACAAGACGACCATGG - Intronic
1166105789 19:40597422-40597444 CTGGTGGTCCAGGAGGACCACGG + Intronic
926633641 2:15158964-15158986 CTGTTGACAGAGGACAACAATGG - Intergenic
928130146 2:28643158-28643180 CTGGTGCCATAGGAAGCCCAGGG + Exonic
929605717 2:43232815-43232837 CAGATCACACAGGACGGCCAGGG + Exonic
930262697 2:49165910-49165932 TTGGTGACCCAGGAAGACTATGG + Intergenic
932090331 2:68800281-68800303 GTGATGACAAAGGAGGACCAAGG + Intronic
932494890 2:72141349-72141371 CTGCTGGCCCAGGACCACCAGGG + Intronic
934577429 2:95411807-95411829 TGGGTGACACAGTAAGACCATGG - Intronic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
938284808 2:130103123-130103145 CTGGTGACAGAGCAAGACCCTGG - Intronic
938334309 2:130477178-130477200 CTGGTGACAGAGGAAGACCCTGG - Intronic
938335452 2:130491675-130491697 CTGGTGACAGAGCAAGACCCTGG - Intronic
938354372 2:130628993-130629015 CTGGTGACAGAGCAAGACCCTGG + Intronic
938430796 2:131235767-131235789 CTGGTGACAGAGCAAGACCCTGG + Intronic
938906013 2:135836768-135836790 CTGGTGGTGCAGGATGACCATGG + Exonic
939083873 2:137694072-137694094 CTGGTGACTCAGGACAATTATGG + Intergenic
946058903 2:216924836-216924858 CTGGTGACACAGCAAGACTTTGG + Intergenic
1169084190 20:2816621-2816643 CTCGTGACCCAGGCTGACCAGGG - Exonic
1170088141 20:12559333-12559355 CTGGTGACAGAGCAAGACCCTGG + Intergenic
1171796647 20:29571803-29571825 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1172768237 20:37362544-37362566 TTGGTCACACAGCAAGACCAAGG - Intronic
1173720058 20:45250022-45250044 CTGGTGACACAGAAATACAAAGG + Intergenic
1174997257 20:55584105-55584127 CCGGTGAGACAGGCTGACCAAGG - Intergenic
1175542759 20:59758099-59758121 CTGGTGACCCAGCAAGACCTGGG + Intronic
1176117446 20:63439251-63439273 CTGGTGACACAGGTCCCTCATGG - Intronic
1176818189 21:13627416-13627438 CTGGTGACAGAGCAAGACCCTGG + Intronic
1179833435 21:44012475-44012497 CCGGTGACGCCGGACGCCCATGG + Exonic
1180475981 22:15707531-15707553 CTGGTGACAGAGCAAGACCCTGG + Intronic
1181149795 22:20875070-20875092 CTGGAGCCACAGGACTTCCATGG - Intronic
1183432470 22:37774169-37774191 CTGGAGACAGAGGGGGACCAGGG - Exonic
1183564960 22:38607685-38607707 CTGGGGACCCAGGGCAACCAGGG + Intronic
1183696805 22:39428226-39428248 CTGGTGCCACAGGACACACACGG - Intronic
1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG + Intronic
1185241179 22:49748633-49748655 CTGGGGAAACAGGAAGACAAGGG - Intergenic
950539170 3:13599749-13599771 TTGTTGACACAGGAAGACCCAGG + Intronic
950835771 3:15917806-15917828 CTGCTGACACAGGGTGACCTTGG - Intergenic
953143327 3:40249565-40249587 CTGGAGACAGGGGAGGACCAGGG + Intronic
960756174 3:121015802-121015824 CTGATGAGACAGGAAGGCCAAGG - Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961786989 3:129353311-129353333 CTGGGGACACACGGGGACCACGG - Intergenic
966493025 3:180550376-180550398 ATGGTAAAACAGGAAGACCAAGG - Intergenic
966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG + Intronic
970404697 4:15751342-15751364 CTGGAGTCACATGACCACCATGG + Intergenic
971331167 4:25682636-25682658 GTGGTGACACAGGTTCACCAGGG + Intergenic
976824560 4:89246473-89246495 CTGGAGACACGGGAGGGCCAAGG + Exonic
981644214 4:146980080-146980102 CTAGTCAGACAGGAAGACCATGG + Intergenic
981948379 4:150376553-150376575 CTGGTTACACATTACAACCATGG - Intronic
982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG + Intronic
982372998 4:154654955-154654977 CTGGTGCCACATGACAGCCAAGG - Intronic
983197590 4:164824506-164824528 CTGAAGACACAGGAACACCAAGG - Intergenic
985588700 5:753821-753843 CTGGTGTCACAGGACGCACCGGG - Intronic
985603367 5:846260-846282 CTGGTGTCACAGGACGCACCGGG - Intronic
990241282 5:53819013-53819035 CTTGTGAAACAGGAAGACCGAGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
997711574 5:136009019-136009041 CTGGGGAGACATGAGGACCAGGG - Intergenic
998502064 5:142642169-142642191 CTGGTGACCCAGGAAGCCAAGGG - Intronic
1000121517 5:158202443-158202465 CTGGTGACTTAGGAACACCAGGG - Intergenic
1000677710 5:164141982-164142004 CTGATGACACAGGATGAAAATGG - Intergenic
1000999386 5:167991350-167991372 CTGGGAACATAGGACGAACAAGG + Intronic
1002055591 5:176596523-176596545 CCGGTCACACTGGGCGACCACGG - Exonic
1006913690 6:37580885-37580907 CTGCTGACCCACGACGAACATGG - Intergenic
1011727263 6:90222872-90222894 CAGGTGACAGAGGATGACTAAGG - Intronic
1012440519 6:99257915-99257937 CTAGAGACACAGGAGAACCAGGG + Intergenic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1019652395 7:2167106-2167128 CCGGTGAAACAGTAAGACCAGGG + Intronic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020272810 7:6607258-6607280 CTGGTGGTACAGCACAACCACGG - Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1037707870 8:21330947-21330969 CTGGTGACCTAGGACCATCATGG - Intergenic
1039739930 8:40373195-40373217 CTGGTGTCACAGAACAACCTTGG - Intergenic
1046039473 8:108884889-108884911 CGGCTGACACATGAGGACCATGG - Intergenic
1047052666 8:121130208-121130230 GTGGACACACAGGAGGACCAAGG - Intergenic
1049214400 8:141401154-141401176 CCTGGGAAACAGGACGACCATGG - Intronic
1049683452 8:143930020-143930042 CTGGTGCCACAGCGTGACCAGGG + Exonic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053789373 9:41675618-41675640 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1054155769 9:61639144-61639166 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054177654 9:61886971-61886993 CAGGTGACAGAGGAGGACCAAGG - Intergenic
1054475538 9:65570145-65570167 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1054659877 9:67693837-67693859 CAGGTGACAGAGGAGGACCAAGG + Intergenic
1057539654 9:95954819-95954841 CCTGTGACACAGCACCACCAGGG - Intronic
1060046268 9:120343802-120343824 CTGGTGACACAGGAGAATTATGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060963010 9:127694527-127694549 TGGGTAACACAGGAGGACCAGGG - Intronic
1061250029 9:129421168-129421190 CCAGTGACACAGAAAGACCAGGG - Intergenic
1061408091 9:130403617-130403639 CTGGGGTCACAGAATGACCAAGG - Intronic
1061786525 9:133031875-133031897 CAGGTGACTCAGGATGACTAAGG + Intronic
1203529170 Un_GL000213v1:122088-122110 CTGGTGACAGAGCAAGACCCTGG - Intergenic
1190720668 X:53144916-53144938 CTTGAGACACAGAACGACTAAGG - Intergenic
1195707241 X:107746482-107746504 CTGGAGAGTCAGGATGACCAAGG - Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1199812137 X:151360347-151360369 CTGGAGCCCCACGACGACCAGGG + Intergenic