ID: 1118905793

View in Genome Browser
Species Human (GRCh38)
Location 14:70022238-70022260
Sequence TTTTCTCCCAAAACGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118905793_1118905796 13 Left 1118905793 14:70022238-70022260 CCTGACTCCGTTTTGGGAGAAAA 0: 1
1: 1
2: 3
3: 15
4: 156
Right 1118905796 14:70022274-70022296 AGTAAATAACATAGATGAGTAGG 0: 1
1: 0
2: 1
3: 24
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118905793 Original CRISPR TTTTCTCCCAAAACGGAGTC AGG (reversed) Intronic
901558182 1:10048147-10048169 TTGCCTCCCAAAACGCATTCAGG - Intronic
904707811 1:32404655-32404677 TTTTTTCCCAAAAGGGAGACTGG + Intergenic
906379180 1:45321023-45321045 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
906484107 1:46221317-46221339 TTCTCTCCCTAAAAGCAGTCAGG - Intergenic
911099966 1:94087695-94087717 TTTTCTCCCCAGGCAGAGTCTGG - Intronic
911237624 1:95428602-95428624 TTTTGTCCCAAAACAGACTTGGG - Intergenic
911737688 1:101355433-101355455 TTCTCTCACAAACTGGAGTCAGG - Intergenic
911809215 1:102252650-102252672 TTTTTTCCCAAGACGGAATCTGG - Intergenic
911989458 1:104674528-104674550 TTTTCTCCCAAATTCAAGTCTGG + Intergenic
912709604 1:111940990-111941012 TTTGCTCCCAAAACAGAGCCTGG + Intronic
917826875 1:178831441-178831463 TTTTCCCCCAAAACAGATTGTGG + Intronic
920951460 1:210575151-210575173 ATTTCTCCCACCACAGAGTCAGG - Intronic
922280101 1:224114768-224114790 TTTTCTCCCCAAACCCAGGCCGG - Intronic
1062814266 10:488212-488234 TTTTCCCCCAAACCAGGGTCTGG + Intronic
1063211860 10:3887993-3888015 TTTCCTGGCAAAACGGAGCCTGG + Intergenic
1064052508 10:12070498-12070520 TTTAATCCTAAAATGGAGTCTGG + Intronic
1065494329 10:26313247-26313269 TTTTTTCCAAAAGCGGAGACAGG - Intergenic
1066003131 10:31123138-31123160 TTTTTTCCCGAGATGGAGTCTGG - Intergenic
1067420170 10:46138364-46138386 TTTCTCCCCAAAAAGGAGTCTGG + Intergenic
1067425850 10:46211156-46211178 TTTCTCCCCAAAAAGGAGTCTGG - Intergenic
1067505516 10:46844852-46844874 TTTCTCCCCAAAAAGGAGTCTGG + Intergenic
1068849200 10:61716974-61716996 TTTTCTCCCCAATGTGAGTCTGG - Intronic
1069304481 10:66951693-66951715 TTTTTTCCCAAAAAGGAAACTGG + Intronic
1070306771 10:75244485-75244507 TTTTCTCCTAGAACAGAGTGTGG - Intergenic
1071611100 10:87031684-87031706 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG + Intronic
1072719147 10:97770369-97770391 TTTTCTCCAAAATAGGAGTAAGG - Intronic
1074071918 10:110079991-110080013 TTCTATCCCAAAACGGAGGTAGG - Intronic
1074093072 10:110281526-110281548 GTTTCTACCAAAACGGTGTAGGG - Intronic
1078373211 11:10769208-10769230 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1079863152 11:25699757-25699779 TTTTATCCAAAAACAGAGTTAGG - Intergenic
1080553648 11:33396303-33396325 TTTTCTGGCAAAAGGGATTCAGG - Intergenic
1081580256 11:44346986-44347008 TTTGCTCCCAAAACAGTGTCAGG - Intergenic
1083336061 11:61922509-61922531 TTTTTTTCCAAGACGGAGTTTGG - Intergenic
1085421618 11:76366667-76366689 TTTTTTTCCGAGACGGAGTCTGG - Intronic
1087145820 11:94810619-94810641 TTTCTCCCCAAAAGGGAGTCTGG + Intronic
1087567389 11:99878942-99878964 TTTTCTCTTGAGACGGAGTCTGG + Intronic
1087900848 11:103638668-103638690 TTTTCTCCCTAAAAGGAATTAGG + Intergenic
1088867902 11:113866278-113866300 TTTTTCCCCAAGACAGAGTCTGG - Intronic
1090815253 11:130288360-130288382 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1093585260 12:20828403-20828425 TTTCTCCCCAAAAAGGAGTCTGG + Intronic
1093596540 12:20969044-20969066 GTTTCTCCCAAAAAGGAGTCTGG + Intergenic
1095572864 12:43702274-43702296 TTTTTTCCCAAATCAGGGTCTGG - Intergenic
1097432328 12:59525901-59525923 TTTTCTACCAGAAAGGAGTGTGG - Intergenic
1097761193 12:63466423-63466445 TATTCTCCCAAGACTGAGCCAGG - Intergenic
1100105143 12:91161791-91161813 TATTCTCTCAAAACTGTGTCTGG + Intronic
1102509764 12:113406639-113406661 TTTCTCCCCAAAAAGGAGTCTGG - Intronic
1105830507 13:24160255-24160277 TTTTTTTAAAAAACGGAGTCTGG + Intronic
1106612859 13:31300186-31300208 TTTTCCCCTAAAACTGACTCTGG - Intronic
1106794442 13:33189982-33190004 TTTTGTCCCAAAAGGGGATCAGG - Intronic
1111740366 13:92197532-92197554 TTTTCTCCCAGGATGGAGTGTGG + Intronic
1114016574 14:18435344-18435366 TTGTCTCTCAAAAGGGATTCTGG - Intergenic
1116173826 14:41438793-41438815 TTGCCTCCCAGAACTGAGTCAGG - Intergenic
1118673883 14:68161588-68161610 TTTCCCCCCAAAAGGGATTCTGG + Intronic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1119255730 14:73194578-73194600 TTTTTTTTCAAGACGGAGTCTGG + Intronic
1125810523 15:42536700-42536722 TTTTCTCCCATAACATTGTCTGG + Intronic
1126455459 15:48856737-48856759 TTTTCTTCCAAATTGGAATCAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131486061 15:92821411-92821433 TTTTCCCCCGAGACAGAGTCTGG - Intergenic
1135009161 16:18858176-18858198 TTTTCTCCAACAACTGATTCTGG + Exonic
1135316197 16:21447083-21447105 TTTTCTCCAACAACTGATTCTGG + Intronic
1135369122 16:21879343-21879365 TTTTCTCCAACAACTGATTCTGG + Intronic
1135442694 16:22491799-22491821 TTTTCTCCAACAACTGATTCTGG - Intronic
1136312874 16:29425805-29425827 TTTTCTCCAACAACTGATTCTGG + Intergenic
1136326308 16:29527573-29527595 TTTTCTCCAACAACTGATTCTGG + Intergenic
1136440997 16:30267558-30267580 TTTTCTCCAACAACTGATTCTGG + Intergenic
1139887512 16:70219877-70219899 TTTTCTCCAACAACTGATTCTGG + Intergenic
1140450664 16:75068458-75068480 CTTTCTCCCACAGCAGAGTCGGG + Intronic
1140813399 16:78599587-78599609 ATTTCTCCCCAAACTGTGTCAGG - Intronic
1141661626 16:85444699-85444721 TTTTCTAGCAACACGGAGCCCGG - Intergenic
1142369972 16:89673869-89673891 TTTCTCCCCAAAAAGGAGTCTGG - Intergenic
1148739734 17:49886041-49886063 TTTTCTCCCCAAAAGGGGTTGGG + Intergenic
1152404626 17:80089767-80089789 TTTTCTCCCAAAGCATAATCTGG - Exonic
1154253173 18:12761114-12761136 TTTTTTTCCGAGACGGAGTCTGG - Intergenic
1157435654 18:47666882-47666904 TTTTCTATCAAAATGGAATCAGG - Intergenic
1157822262 18:50781194-50781216 TTTTCTTACAAAAAGAAGTCTGG + Intergenic
1158280079 18:55814714-55814736 TTTTTTCCCAAAAAAGAGTTTGG - Intergenic
1159879354 18:73844018-73844040 TTTTCTGTCAAAATGGATTCTGG - Intergenic
1161126228 19:2559524-2559546 TTTTCTCTCAAGATGGAGTTTGG + Intronic
1163478724 19:17542105-17542127 TTTTCCCCCAAAACTGCTTCCGG + Intronic
1164070611 19:21764626-21764648 TTTTTTCCCCACACGGAGTCTGG - Intronic
1164498597 19:28793207-28793229 TTCTGCCCCAAAAGGGAGTCTGG + Intergenic
1165638258 19:37362334-37362356 TACTCTCCCAAACAGGAGTCTGG - Exonic
1168535620 19:57166799-57166821 TTTTCCCCCATAACACAGTCAGG - Intronic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
925662658 2:6219387-6219409 TTTTCTCTCACGTCGGAGTCAGG - Intergenic
926286111 2:11489445-11489467 TTTTCCCCCAAGACGGAGTCTGG - Intergenic
926861459 2:17314549-17314571 TTATCTCTCAGAATGGAGTCTGG - Intergenic
931118382 2:59189358-59189380 TTTTCTCCCAAAAAGGAGAATGG - Intergenic
932275593 2:70449964-70449986 TTTTCTCCCAGAACGTATTGAGG + Exonic
932655797 2:73610252-73610274 TTTAATCCCAAAACCGAGTGTGG - Intronic
932932212 2:76055415-76055437 TTTACTCCTAAAACTGAGTTGGG - Intergenic
933112406 2:78420370-78420392 TTTTCTCACAATTTGGAGTCTGG + Intergenic
933178234 2:79200502-79200524 TTTCTCCGCAAAACGGAGTCTGG + Intronic
935957898 2:108396962-108396984 GTCTCTCCCCAAAGGGAGTCTGG + Intergenic
937510626 2:122591130-122591152 TTTTCTCCCACAAGGATGTCTGG + Intergenic
939194104 2:138951334-138951356 TTTACTCCTAAACCTGAGTCTGG - Intergenic
944097585 2:195986141-195986163 TTTCCTCCCAAGATGGAGTTTGG - Intronic
946817197 2:223591316-223591338 TTCTCCCCCAAAAAGGAATCAGG + Intergenic
947041975 2:225932723-225932745 CTGTTTCCCAAAACAGAGTCTGG - Intergenic
947112808 2:226737757-226737779 TTTTCTTCCAAAACCAAGCCAGG - Intronic
948384523 2:237573322-237573344 TTACCTCCCAAAACAGGGTCTGG + Intergenic
1169208899 20:3754819-3754841 TTTTCTCCCAAAAGGAAGGCAGG + Intronic
1169225179 20:3852004-3852026 TTTTCCCCCGAGACGGAATCTGG + Intronic
1171118120 20:22544589-22544611 TTTTCTCTCAGACGGGAGTCTGG - Intergenic
1171308826 20:24129315-24129337 TTTCCTCCCAAAACCAAGTTTGG - Intergenic
1174296883 20:49552041-49552063 GTTTCTCCCCAGAAGGAGTCTGG - Intronic
1174640163 20:52036935-52036957 TGTTCTCCCAAACCTGGGTCAGG - Intergenic
1175117529 20:56693536-56693558 TTCTGTCACAAACCGGAGTCTGG + Intergenic
1175252924 20:57620511-57620533 TTTTCTCCTGAAACCGAATCTGG - Intronic
1178077793 21:29028445-29028467 TTTTTTCCTGAGACGGAGTCTGG + Intronic
1178198358 21:30374824-30374846 TTTTTTTCCGAGACGGAGTCTGG + Intronic
1178878582 21:36431080-36431102 TTGTTTCTCAAGACGGAGTCTGG + Intergenic
1180441080 22:15366217-15366239 TTGTCTCTCAAAAGGGATTCTGG - Intergenic
1183567615 22:38627072-38627094 TTTTCTCTAGAAACAGAGTCTGG - Intronic
1183679923 22:39322122-39322144 TTTTTTTCCGATACGGAGTCTGG + Intergenic
950918868 3:16672395-16672417 TTTCTCCCCAAAAGGGAGTCTGG - Intergenic
961882939 3:130075618-130075640 TTTTCTCCTACAACTGACTCTGG + Intergenic
964807837 3:160631092-160631114 TTTTCTCCCCAGAAGGAATCTGG + Intergenic
966095846 3:176202156-176202178 TTTTTTCCTGAGACGGAGTCTGG + Intergenic
968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG + Intronic
970349782 4:15190680-15190702 TTTTCTTCAAAAACGTAGGCCGG - Intergenic
971913615 4:32829061-32829083 TTTCTTCCCCAAAGGGAGTCTGG + Intergenic
972257658 4:37375578-37375600 TTTTTTTCCGAGACGGAGTCTGG + Intronic
972511920 4:39774599-39774621 TTTTCCCCTGAGACGGAGTCTGG - Intronic
974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG + Intergenic
977689181 4:99884952-99884974 TTTTCTTCCAAGACAGAGTCTGG - Intronic
984031347 4:174607605-174607627 TTTTTCCCCAAAAGAGAGTCTGG - Intergenic
984534892 4:180962326-180962348 TTTTCTCCCAATAAGGAACCTGG + Intergenic
984749879 4:183261993-183262015 TTTTCGCCAGAAAAGGAGTCTGG - Intronic
987587155 5:19870350-19870372 TTTTCTCCCAAAACTGTATTAGG - Intronic
989982382 5:50659796-50659818 TTTTCTCCCAAAACAGATCTAGG - Intergenic
992105315 5:73445170-73445192 TTTTCTCCCTAAAAAGAGACAGG + Intronic
992489737 5:77230811-77230833 TCTTCTCCCAGACTGGAGTCAGG - Intronic
994737071 5:103568482-103568504 TTTTCCCCCGAGATGGAGTCTGG - Intergenic
995024438 5:107402910-107402932 TTTTATGCCAAATCAGAGTCTGG + Intronic
1001454068 5:171847412-171847434 CTTTCTCCCAATAAGGACTCTGG + Intergenic
1002910702 6:1488995-1489017 TCTTCCCCCAAGACAGAGTCTGG - Intergenic
1005746647 6:28844282-28844304 TTTTCTTTCAAGACGGGGTCTGG - Intergenic
1014110378 6:117614002-117614024 TTTCTCCCCAAAAGGGAGTCTGG - Intergenic
1015683758 6:135836115-135836137 TTTTCTGCCTAAACGGGATCAGG - Intergenic
1023883188 7:44333185-44333207 TTTTCTCCTGAGACAGAGTCTGG - Intronic
1024230113 7:47357496-47357518 TCTTCTCCCAAAACTGAAACAGG + Intronic
1024998975 7:55297886-55297908 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1027665215 7:81036278-81036300 TTTTCTGCCAAAACGGAATTCGG - Intergenic
1027876484 7:83776740-83776762 ATTTTTTCCAAAACGGAGTGAGG + Intergenic
1028758275 7:94463524-94463546 TTTTCTCCCAAGACTGGGTGTGG - Intergenic
1030156442 7:106460380-106460402 GTTTCTCCCAAGACAGAGTGGGG - Intergenic
1031059339 7:117032527-117032549 TTTTCTCTAAAAACAGATTCAGG + Intronic
1032151077 7:129430528-129430550 TTTTCAACTAAAAGGGAGTCAGG - Intergenic
1033782039 7:144683197-144683219 TTTTTTCCTGAAATGGAGTCTGG + Intronic
1034657853 7:152743494-152743516 TTTTTTTCCAAGATGGAGTCTGG - Intergenic
1035633142 8:1123758-1123780 TTTTATTCCTAAAGGGAGTCAGG - Intergenic
1038265100 8:26033232-26033254 TTTTCCCCCCAGACAGAGTCTGG + Intronic
1039500494 8:38012684-38012706 GCTTCTCCTAAAAAGGAGTCTGG - Intergenic
1040404080 8:47082878-47082900 GTTCCTCCCAAAAAGAAGTCTGG + Intergenic
1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG + Intronic
1042132053 8:65596886-65596908 TTATTTCCTAAAACTGAGTCTGG + Intergenic
1043682986 8:83054608-83054630 TTTTCTCCCGAGACCAAGTCTGG + Intergenic
1051174630 9:14349493-14349515 GCTGCTCCCAAAACGGAGTGGGG - Intronic
1051419416 9:16874863-16874885 TTTTTTTTCAAGACGGAGTCTGG - Intergenic
1053060297 9:35025373-35025395 TTTCTTCCCGAAAGGGAGTCTGG + Intergenic
1185721960 X:2389379-2389401 TTTCATCACAAAACAGAGTCTGG - Intronic
1186783631 X:12939104-12939126 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1189503474 X:41586225-41586247 TTTTCTCCCAAAGGGCAGTGAGG + Intronic
1189863856 X:45302354-45302376 GTTTCTCCCAAAAAGGAGTTTGG - Intergenic
1191616957 X:63180247-63180269 TTTTTTTCCAAAAGGGAGTCTGG + Intergenic
1191619340 X:63198676-63198698 TTTTTTTCCAAAAGGGAGTCTGG - Intergenic
1192093544 X:68186098-68186120 TTTTCTCCCAAAATAAACTCTGG - Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1195098790 X:101532932-101532954 TATTCTCCCAACAGGGAGGCAGG - Intronic
1196869963 X:120103369-120103391 TTTCTCCCCAAAATGGAGTCTGG - Intergenic
1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG + Intergenic
1199446627 X:147930941-147930963 TTTTCTCCTAAAATGCAGTTTGG - Intronic
1200242063 X:154501901-154501923 TTTTTTTCTGAAACGGAGTCTGG - Intergenic