ID: 1118909591

View in Genome Browser
Species Human (GRCh38)
Location 14:70050128-70050150
Sequence CCTCCTTTGTAAAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118909591 Original CRISPR CCTCCTTTGTAAAAGGAGCA GGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901714009 1:11138649-11138671 CCTCCTTCTTAAAAGGAAGAGGG - Intronic
901790204 1:11649932-11649954 CCTCCTTTGAGTAAGGAGAAGGG - Exonic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902785981 1:18733021-18733043 CCTCCTTTGAGCAGGGAGCAGGG + Intronic
904007334 1:27370310-27370332 CCTCCTCTATAAAATGGGCAGGG - Intronic
904388471 1:30163152-30163174 CCTCCTTTGGAAAACGGGGATGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
910938168 1:92504240-92504262 CTCTCTTTGTAAATGGAGCATGG + Intergenic
912398572 1:109368734-109368756 CCTCCTTTGTGGCAGGGGCAGGG + Intronic
913243683 1:116852592-116852614 CCTCTTCAGTAAAAGAAGCACGG - Intergenic
917370925 1:174293298-174293320 CCTATTTTGTTAAAGGAGTAAGG - Intronic
919403606 1:197149043-197149065 ACACCTTGGTAAAAGGAGAATGG - Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
921605522 1:217149310-217149332 TCATCTTTGAAAAAGGAGCAAGG + Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923791541 1:237115305-237115327 CATCCATTGTACAAGAAGCACGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924456971 1:244226698-244226720 CTTCCTTTTTAAAAGAAGGAAGG + Intergenic
1062853690 10:767491-767513 CCTCCTTTATTCAATGAGCAAGG - Intergenic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1065632582 10:27695612-27695634 CTTCCAATGTGAAAGGAGCAAGG + Intronic
1065760666 10:28979881-28979903 TTTCCTTTGTAAATGGAGAAAGG + Intergenic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1066038128 10:31515009-31515031 CCTCCTTTGCACAATTAGCAGGG + Intronic
1066540985 10:36446757-36446779 CCACTTTTTTAAAAGGAGAAAGG + Intergenic
1067352093 10:45485579-45485601 CCTTCTTTGAAAATGGAGCCTGG + Intronic
1067726597 10:48775303-48775325 GCTCCTGTGTATAAGCAGCAGGG - Intronic
1069063152 10:63914941-63914963 CCTCCCTTTTCAGAGGAGCATGG + Intergenic
1069855952 10:71441126-71441148 TCTCCTCTGTAAAATGAGCTGGG - Intronic
1071474313 10:86012456-86012478 CCTGCCTTGTAAAAGGTTCAGGG - Intronic
1071600291 10:86955662-86955684 CCTCCCTGGTCACAGGAGCAAGG + Intronic
1072215138 10:93281459-93281481 CCTCCTTAGAAATAGGAGCTTGG - Intergenic
1072584691 10:96771017-96771039 CCTCCTTTGTAAAACTAACAAGG - Intergenic
1073025589 10:100485153-100485175 TCTACTTTGTAAAGGGACCACGG - Intergenic
1073543612 10:104331462-104331484 CCTCCTGTATCAAAGCAGCAGGG - Intronic
1073794361 10:106971901-106971923 TCTTCTGTGTAATAGGAGCAAGG + Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074109007 10:110409365-110409387 CCTCCTCTCTAAAGGGAGTAAGG + Intergenic
1074181750 10:111071391-111071413 CTTCCTTGGTAAAAGGACCACGG - Intergenic
1074372991 10:112915419-112915441 CCTCATTTGTAATATGTGCAAGG + Intergenic
1075990705 10:126836395-126836417 CTGCCCTTGCAAAAGGAGCAAGG + Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077900527 11:6483872-6483894 CCTGCTGTGTAAAATGAACATGG - Exonic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1079666462 11:23112605-23112627 CCTTCTGTGTAAATGAAGCAGGG - Intergenic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1083319172 11:61834852-61834874 CCGCCTATGCAAAATGAGCAAGG - Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085192720 11:74642312-74642334 CCTTCTTTTTAAAAGGAAAAAGG + Exonic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1087576233 11:99993373-99993395 CCTCATTTCTAAAAGAAGAAGGG + Intronic
1089049690 11:115535469-115535491 CCTCATTAGAAAAAAGAGCAAGG - Intergenic
1089601106 11:119615857-119615879 CCTCCTTGGTAAAATGAGTAAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1090543527 11:127735715-127735737 CCTCCTTCCCAAAATGAGCAAGG - Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1093068074 12:14679612-14679634 CTTCCTTTTTGAAAGGAGGAGGG + Intronic
1093784334 12:23175175-23175197 CCTCTTTTTTAAAAAGAGAAAGG - Intergenic
1096955931 12:55526070-55526092 GCTCTTTTGTAAAGAGAGCAGGG - Intergenic
1097122917 12:56749736-56749758 CCTCCTTTGTAAAAAGAATGAGG + Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1099956509 12:89355905-89355927 ACTGGTGTGTAAAAGGAGCAGGG - Intergenic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1100875193 12:98954483-98954505 CCTCCCTTGCAAATGGAACAAGG + Intronic
1102437984 12:112940086-112940108 TCTCCTTTGTAAAGTGAGCACGG + Intronic
1102550121 12:113685507-113685529 GCTCGTTTGGAAATGGAGCAAGG + Intergenic
1104523249 12:129495124-129495146 CCCCCTTTGTAAAGGTAACAAGG - Intronic
1104604417 12:130177464-130177486 ACTGCTTTGTCAAAAGAGCATGG - Intergenic
1106033125 13:26020356-26020378 CATCCTGTGTAATTGGAGCAGGG + Exonic
1106402318 13:29442280-29442302 CCTCCTTTCTAAATAGAGCTGGG - Intronic
1106412752 13:29522523-29522545 CCTCCGTGGTAAACCGAGCATGG - Intronic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107902070 13:45026902-45026924 CCTCCTTTGTTAAATGAGAAAGG + Intronic
1109834787 13:67843030-67843052 GCTTCTATGAAAAAGGAGCAAGG - Intergenic
1110041076 13:70759964-70759986 ACTCATTTTTAAAAGGAGCCGGG + Intergenic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1112355800 13:98674048-98674070 CCTCCACTGTCATAGGAGCAGGG - Intergenic
1113649232 13:112023711-112023733 CCTCTTTTCTAAAAGTAGCCGGG - Intergenic
1115652787 14:35415129-35415151 CATCCTTTGTAAAATGGGAATGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1118254419 14:64193054-64193076 CTTCCTTTGTACAAGGCCCAGGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1119842835 14:77806227-77806249 CCACCTTTGTAAAACTAACAAGG - Intronic
1120030630 14:79636810-79636832 GCTCCTCTGCCAAAGGAGCATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1122761939 14:104035126-104035148 CTTTCTTTCCAAAAGGAGCAAGG - Intronic
1123439679 15:20281379-20281401 TCTCCGTAGGAAAAGGAGCAGGG + Intergenic
1124828983 15:33129303-33129325 CCTCATTTGGAAAAGAAGTATGG - Intronic
1124896389 15:33781099-33781121 CCTCTTTTGTAAAATGATCCTGG + Intronic
1125673972 15:41493158-41493180 CCTCCTCTGTTATAGGAGCTCGG - Intergenic
1127407317 15:58664530-58664552 CATCCTTTCTAAAAGTAGTATGG - Intronic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128616096 15:69111196-69111218 CCTGCTTTGAGAAAGAAGCAAGG - Intergenic
1130833591 15:87628134-87628156 CCTCTTTTGTAAAGGGAGCTGGG + Intergenic
1131112661 15:89775473-89775495 CCTTCTTTATAAAACGATCATGG + Intronic
1131889815 15:96960677-96960699 CCTATTTTGTAAATGAAGCATGG - Intergenic
1132422159 15:101679832-101679854 CTTCCTTTCTAAAAGGAGCTTGG - Intronic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1133752334 16:8734533-8734555 CCTCCTCTGTAAAAAGACCATGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134470403 16:14520184-14520206 CCTCGTTTGTTGAAGAAGCAAGG - Intronic
1136114849 16:28088014-28088036 CCCCCTTGGAAAAAGGAGAAGGG + Intergenic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1137399219 16:48139707-48139729 CCTCCTTTGTGGAAGGAGTGTGG + Intronic
1137435987 16:48454556-48454578 ACTCCTTTATGAAAGGAGCATGG - Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137680079 16:50334358-50334380 CCTCCTTCCATAAAGGAGCAAGG - Intronic
1138677825 16:58664962-58664984 CCTGCTTGGTAGAGGGAGCATGG + Intergenic
1138898482 16:61239810-61239832 CCTCATTTCCAAAAGGAGTAGGG - Intergenic
1139851511 16:69953425-69953447 GCTCATCTGTAAACGGAGCAGGG - Intronic
1139880487 16:70176337-70176359 GCTCATCTGTAAACGGAGCAGGG - Intronic
1140372023 16:74419180-74419202 GCTCATCTGTAAACGGAGCAGGG + Intronic
1140914949 16:79484587-79484609 CCTCCCTTGGAAAAGGCCCAGGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142830132 17:2542670-2542692 CCCCCTGTGAAAAAGGAGAAGGG + Intergenic
1143450898 17:7036202-7036224 CCGCCTTGGGAAAAGGTGCAGGG + Exonic
1145748675 17:27339670-27339692 CCTCCTTTGTCACTGGAGAAAGG + Intergenic
1146000200 17:29126286-29126308 CCTCCCTTGTGAGAGGAGGAGGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146367433 17:32239842-32239864 CCTCCTTTGTATAAAGTGCTGGG + Intronic
1146975098 17:37104528-37104550 ACTGCTTTGTTTAAGGAGCATGG - Intronic
1148741135 17:49893459-49893481 CCTCCTCTGTACAAGGTGCTGGG - Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1149277963 17:55065972-55065994 CTTTCTTTGCAAAATGAGCATGG + Intronic
1152501947 17:80717990-80718012 TCTTCTTTGCAAAAGGAGAAAGG + Intronic
1153291355 18:3505147-3505169 CCTCCTGGGGCAAAGGAGCATGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154974077 18:21439948-21439970 CCCATTTTGTAAAAGGAGAAAGG - Intronic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1156696674 18:39775913-39775935 TCTCCTTGATAAAAGGAACAAGG + Intergenic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160169906 18:76544417-76544439 TCTCCTATGTAATAGGAACAGGG - Intergenic
1160390894 18:78531765-78531787 CCACCCATGGAAAAGGAGCAAGG + Intergenic
1161814264 19:6489788-6489810 GCTCCTTTGTATAGGGAGAAAGG - Intergenic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164741689 19:30580584-30580606 CCTCCTTTGGAAGAGGGGCTGGG - Intronic
1166213333 19:41320955-41320977 CCTGCTTTGGAAAAGGACCCAGG + Intronic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166785138 19:45363074-45363096 CCTCCTTTGTAAAATGGCCAAGG - Intronic
1167809207 19:51813842-51813864 CCTCCTTTATAAAATGAGACAGG + Intronic
1168111898 19:54197287-54197309 CTTCCTCTCTGAAAGGAGCACGG - Intergenic
926104161 2:10139854-10139876 CCTCCAATGTTAACGGAGCAGGG + Intergenic
926419589 2:12683574-12683596 CTTCGTTTGTAAAAGTAACAAGG - Intergenic
926856301 2:17259880-17259902 CCTCCTTTTTAAAACAAGGAAGG + Intergenic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
929192812 2:39155292-39155314 CCTCCTAAGTAAAAGGAGTCAGG + Intergenic
929693159 2:44091364-44091386 CTTCCCTTGTAAAACGAGGATGG - Intergenic
929726020 2:44428401-44428423 CCTCCATTGGCAGAGGAGCAGGG - Intronic
929806467 2:45150650-45150672 CATCCCTAGAAAAAGGAGCATGG - Intergenic
930517995 2:52432202-52432224 CCTCCTTGGTGAAAGGTGGAGGG - Intergenic
931647758 2:64440628-64440650 CATCCTCTGGAAAATGAGCATGG - Intergenic
931753470 2:65350947-65350969 CCTCCTTTGCAAAATGAATAGGG + Intronic
931941765 2:67259793-67259815 CACCCTTTCAAAAAGGAGCATGG + Intergenic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933892600 2:86785569-86785591 CCCCCTTTGTAAAACGGGCGGGG + Exonic
938231320 2:129662496-129662518 ATTCCTCTGTAAAAGGAGCCAGG + Intergenic
938760696 2:134423245-134423267 CCTCTTTTGTAGAGGAAGCAGGG - Intronic
939159777 2:138574145-138574167 CATCCTTTACAAAAGGAACAAGG - Intergenic
939588890 2:144039292-144039314 CCTCTTTAATAAAAGGAGCAGGG - Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
941079734 2:161046531-161046553 CCAGCTTTGAAAATGGAGCAAGG + Intergenic
943064854 2:183074809-183074831 CCTTCTTTATAAAAAGAGAATGG + Intergenic
944108314 2:196103363-196103385 CCTCCTTTTTATAAGGATCTTGG - Intergenic
944776577 2:202972946-202972968 CTTTTTTTGTAAAAGAAGCAGGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945260213 2:207836107-207836129 CCTTCTTTGGGATAGGAGCAGGG + Intronic
946161834 2:217840248-217840270 CCTCCAGTGTCAGAGGAGCAGGG + Intronic
947438873 2:230099575-230099597 CCAGCTTTGTAAAAGGACAAAGG - Intergenic
1169213727 20:3781989-3782011 CCTCCTTTGTGAAATGACGATGG + Intergenic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1173158646 20:40636286-40636308 CCACCTTTGCAAAAGGACCTGGG + Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1174052435 20:47776382-47776404 CCTCCTTTGTAAAACGGGGTTGG + Intronic
1174297908 20:49562038-49562060 CCTCCTCTGTAAAATGGGCCTGG - Intronic
1174911515 20:54612915-54612937 TCTCCTTTGTAAAATGGGAAGGG + Intronic
1178757702 21:35368239-35368261 CTGCCTTTGTTAAAGGAGAATGG - Intronic
1179096094 21:38315608-38315630 CATACTTTGTAAAAAGAGAATGG + Intergenic
1180175482 21:46085120-46085142 CCTCCTCTGTCACAGGGGCAGGG - Intergenic
1180175537 21:46085376-46085398 CCTCCTCTGTCACAGGGGCAGGG - Intergenic
1182093789 22:27613134-27613156 CCTCATTTGTCAAGTGAGCATGG + Intergenic
1182571716 22:31244103-31244125 AGTCCTTTGTAAGAGGAGTAGGG + Intronic
1182658136 22:31905928-31905950 CCTCCTTAGTTAAAGGGGCAAGG - Intronic
1183060527 22:35333815-35333837 CCTCCTCTTTAACAGGAGTAGGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1184093087 22:42302492-42302514 CTTCCTCTGTGAAAGGGGCATGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184875924 22:47275558-47275580 CCTCCTTTCTGTAGGGAGCAGGG + Intergenic
950900405 3:16492435-16492457 CCTCATCTATAAAAGGAACACGG - Intronic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
952547597 3:34437211-34437233 CCCTCTTTGTAAGAGCAGCAGGG + Intergenic
953409961 3:42685319-42685341 CCTCATTTCTAAATGGAGCACGG - Intergenic
953780904 3:45869628-45869650 CCTCCTTTGTGGAAGGTGCCTGG + Intronic
954078278 3:48196955-48196977 CCTCCTCTGTGAAATGAACACGG - Intergenic
954489672 3:50891402-50891424 CATGTTTTGTAAAAGGAGAAGGG - Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954842819 3:53526871-53526893 CCTAATTTGTCAAATGAGCAGGG + Intronic
955532978 3:59893604-59893626 CTGCCTTTGTAAAAGGAAAAAGG + Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955976915 3:64488761-64488783 CTTCCTCTGTAAAAGCAGCATGG + Intergenic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956718628 3:72099385-72099407 CCTCCCTAGTAAAAGCAGGAAGG - Intergenic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
975635914 4:76447975-76447997 CCTTCTCTGTTAAAGAAGCAAGG - Intronic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979621875 4:122807074-122807096 CCTAGTTTGTAAAAGGAGTTGGG + Intergenic
981127318 4:141121450-141121472 CCTACTTGGTAAAAACAGCACGG + Intronic
983338848 4:166431444-166431466 CCTACATCGTAAAAGGTGCATGG - Intergenic
983839170 4:172435026-172435048 GCTCCTCAGTAAAAGGAGAATGG + Intronic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
985685349 5:1279060-1279082 CCTCCTTGGGAATAGGAGCCCGG + Intronic
988102492 5:26699506-26699528 CTACCTTTGTAAATGGAGAAAGG - Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
990821862 5:59850371-59850393 GCCCATTTGTAAAATGAGCATGG + Intronic
991622584 5:68560168-68560190 ACTTCTTTGTAAACTGAGCAGGG + Intergenic
993414844 5:87614287-87614309 CCTCCTTTGCAAAAGGATGTAGG + Intergenic
993465417 5:88240127-88240149 GCTCCTTTGTGGAAGGAGTAGGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995492674 5:112708853-112708875 CCTCCTTTATTAGTGGAGCAAGG + Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997625368 5:135327403-135327425 CCTCCTGGGTAAAAAGACCAGGG - Intronic
999989572 5:157037104-157037126 CCTCATTTGTAAAAGTCACATGG - Intronic
1000132464 5:158313293-158313315 CCTGCTGTGCAAAAGGAGCCGGG + Intergenic
1001003715 5:168031259-168031281 CCTCTTTTGTAAAATGAGTCTGG + Intronic
1003374218 6:5559897-5559919 GCTTCTGTGTAAATGGAGCAGGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1006450587 6:34103697-34103719 CCTCCTTGGAAAAGGGGGCATGG - Intronic
1006623098 6:35380799-35380821 CCTCATTTGTAAAACAGGCATGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007458198 6:41997109-41997131 CCTCCTTTGTCAAAGAAGACAGG - Intronic
1008352771 6:50512778-50512800 CCTTCTTGATAAAAGGAGAAAGG - Intergenic
1008977486 6:57444913-57444935 TCTGCTTTAAAAAAGGAGCAAGG - Intronic
1009165621 6:60337864-60337886 TCTGCTTTAAAAAAGGAGCAAGG - Intergenic
1011309749 6:85968753-85968775 TCACCTGTGTAAAAGTAGCAAGG - Intergenic
1011971642 6:93231876-93231898 TCTCGTTTGTAAAATGAGAATGG - Intergenic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1016145484 6:140667142-140667164 TCTCCTTTGTAATAGGAAAAAGG + Intergenic
1017453430 6:154575858-154575880 CCTGCTGTGTTAAAGGATCAGGG + Intergenic
1019408780 7:897717-897739 TCTCCCGTGTACAAGGAGCATGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019706018 7:2497749-2497771 CCTCCTGTGTACTGGGAGCAGGG - Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1023272247 7:38476762-38476784 CCTCCTCTATAAAAGGAGATTGG - Intronic
1023552219 7:41382693-41382715 TCTCCCTTTTAAAAGGATCAAGG + Intergenic
1026534206 7:71226866-71226888 TCTCCTTTGGAAAAGAAGCTGGG + Intronic
1027124664 7:75547810-75547832 TCTCCTGTGAAAAAGAAGCATGG + Exonic
1027647188 7:80816822-80816844 TCTCCTTTGGAAAACCAGCATGG - Intronic
1028358292 7:89936247-89936269 CCTGTGTTGTAAAAGGAGCTAGG + Intergenic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030666096 7:112280528-112280550 CCTCTTTGCTAAAAGGAGAAAGG + Intronic
1030684717 7:112473357-112473379 CCTCATTTGTAAAACGAGTCTGG - Intronic
1032611741 7:133422858-133422880 CTTACTTTTTAAAAGGAGAAAGG + Intronic
1034464570 7:151219012-151219034 CCTCCTGTCTGAAAGAAGCAGGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035651565 8:1269642-1269664 CCACCTTTGTAAAATGACCTTGG + Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1040878835 8:52181849-52181871 CCTTCTTTGTCAAAGGAGACTGG + Intronic
1040904889 8:52457768-52457790 GCTCGTTGGTAAAAGGAGCCTGG + Intronic
1041307190 8:56473461-56473483 ACTCATTTATAAAATGAGCAAGG + Intergenic
1041379464 8:57238881-57238903 CCTCCTTTAATAAAGAAGCATGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042479521 8:69287718-69287740 CCTCCTGTTTATAATGAGCATGG - Intergenic
1043385658 8:79745104-79745126 CTTCCTTAGTAAAAGGACCCTGG - Intergenic
1043950023 8:86298631-86298653 CCTCCTTGCTAGGAGGAGCAAGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044897979 8:96913062-96913084 CCTCCTTTCTAAGAGAAGAAGGG - Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1047104479 8:121718447-121718469 GCTCCTTTGTTCAAGCAGCAAGG + Intergenic
1048291290 8:133183576-133183598 CCTCTTTTATAAAAAGAGGATGG - Intergenic
1049805011 8:144534768-144534790 CCTCCTTTGAGAAAGGAGACTGG - Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050624532 9:7488763-7488785 TCTCCTATGTAAAAGGTGCTAGG - Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG + Intergenic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1057839329 9:98472808-98472830 CATCTTAGGTAAAAGGAGCACGG + Intronic
1059620411 9:115998478-115998500 CCTTCTGTGTAAAATGAGAATGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060398049 9:123329909-123329931 CCTCCTTTTTCCCAGGAGCAAGG - Intergenic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1061521251 9:131119598-131119620 GCTCCTTTGTAAAATGAGACAGG - Intronic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1188619966 X:32208395-32208417 CCTTCTTTACAAAAGGAGCCAGG + Intronic
1192012688 X:67291951-67291973 ACTCCTTGGGAAAAGTAGCAGGG - Intergenic
1193223021 X:78949411-78949433 CCTCTTTTGTAAAATTAGAATGG - Intronic
1193352833 X:80482231-80482253 CCTCTTCTTTAAAAGCAGCAGGG + Intergenic
1193729313 X:85083098-85083120 CACCCTTTGTAAAGAGAGCAAGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194796056 X:98212136-98212158 CCTCCTTTTTAATAGGAATAGGG + Intergenic
1195706675 X:107742637-107742659 CCTCCTTCATAAAAGGAGCAAGG + Intronic
1195721042 X:107868546-107868568 ACTTCTTTGTAATAGGAGAAAGG + Intronic
1195766222 X:108298806-108298828 CCTCCTTCATAAAAGGAGCAAGG - Intronic
1197955436 X:131941805-131941827 CTTCCTTTTTAAAAGGAGTAAGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199421823 X:147653410-147653432 ACTATTTTGTAAAAGAAGCATGG - Intergenic
1201675950 Y:16584276-16584298 CAGCCTTTGGAAATGGAGCAGGG - Intergenic