ID: 1118911686

View in Genome Browser
Species Human (GRCh38)
Location 14:70066968-70066990
Sequence CAGGATGCATGATAGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118911686_1118911692 17 Left 1118911686 14:70066968-70066990 CCCAGGTCCTATCATGCATCCTG 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1118911692 14:70067008-70067030 GAGCCCTTACCATGGCCTATGGG 0: 1
1: 0
2: 1
3: 9
4: 92
1118911686_1118911690 9 Left 1118911686 14:70066968-70066990 CCCAGGTCCTATCATGCATCCTG 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1118911690 14:70067000-70067022 TACACACAGAGCCCTTACCATGG 0: 1
1: 0
2: 1
3: 27
4: 243
1118911686_1118911691 16 Left 1118911686 14:70066968-70066990 CCCAGGTCCTATCATGCATCCTG 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1118911691 14:70067007-70067029 AGAGCCCTTACCATGGCCTATGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118911686 Original CRISPR CAGGATGCATGATAGGACCT GGG (reversed) Intronic
902311865 1:15587191-15587213 CTGGATGCTTGACAGCACCTGGG + Intronic
903130092 1:21273551-21273573 CAGTATGGATGACAGGACATAGG + Intronic
903987638 1:27240375-27240397 GAGGATACATGATTGGCCCTAGG - Intronic
909295405 1:73941209-73941231 CAGGAAGACTGATAGGACCATGG - Intergenic
910308913 1:85800803-85800825 AAGGATGCATGCTCTGACCTAGG - Intronic
910832011 1:91470760-91470782 CAGGATGCATCAGAGAGCCTTGG + Intergenic
919403612 1:197149097-197149119 CAGCATCCATGAAAAGACCTGGG + Intergenic
922181940 1:223242581-223242603 CAGGATGCCTGATAGTGACTGGG + Intronic
923341382 1:233010037-233010059 CAGGATGCAATATCTGACCTAGG - Intronic
924425011 1:243942816-243942838 CAGGATTGATTCTAGGACCTGGG - Intergenic
924813803 1:247425568-247425590 CAGGCAGCATGAGAGGAGCTTGG - Exonic
1063845119 10:10119030-10119052 AAGGAAGCAGGATAGAACCTGGG - Intergenic
1064891666 10:20181978-20182000 CAGGAGGTATGATAGTAACTTGG + Intronic
1068012610 10:51472771-51472793 CAGCAAGCATGACAGTACCTGGG - Intronic
1070170371 10:73928302-73928324 CAGGATGCATCCTAACACCTGGG + Intergenic
1071493887 10:86154610-86154632 CAGGCTCCATGCTTGGACCTGGG - Intronic
1073247441 10:102101578-102101600 CAGCATGAAAGCTAGGACCTTGG - Intergenic
1074301748 10:112239914-112239936 CTGGATGCAGGATAAGAACTTGG - Intergenic
1075125422 10:119695191-119695213 CTGGATGCATGACAAGAACTTGG - Intergenic
1081276616 11:41157259-41157281 CAGGATGCATGATAGGTTCATGG + Intronic
1084582382 11:70032102-70032124 GAGGAGGCAGGAAAGGACCTGGG + Intergenic
1084962379 11:72723765-72723787 CTGGATGCCTAATAGGCCCTTGG - Intronic
1085440497 11:76558212-76558234 CAGGATCCACGATAGAACGTGGG + Intergenic
1085855310 11:80169543-80169565 CAGGAGATATGGTAGGACCTTGG - Intergenic
1086284832 11:85235344-85235366 AAGGATGGATGAAAGGACATAGG - Intronic
1088626046 11:111731469-111731491 CAGGATGCAGGAGAGCAGCTTGG - Intronic
1092126834 12:6080513-6080535 CTGGATGCAACATAGGACTTAGG + Intronic
1094221049 12:27993924-27993946 CAGGATGTTTCATAGGATCTTGG + Intergenic
1095632330 12:44392814-44392836 CAGGGAGCATGATGAGACCTGGG + Intergenic
1096633113 12:52942218-52942240 AAGCATGTATGATAGGGCCTGGG - Intronic
1101256886 12:102987439-102987461 CAGGAAGGATGGTAGGAACTTGG + Intergenic
1101496133 12:105256026-105256048 CAGGATCTATGCTAGGAGCTGGG + Intronic
1101785418 12:107878690-107878712 CAGGAGGCATGAAACGACTTAGG - Intergenic
1101840894 12:108326805-108326827 CAGGGTGCATGCGAGGCCCTTGG - Intronic
1107099565 13:36575007-36575029 CAGGATAAATGCTAGGACCATGG + Intergenic
1111673356 13:91356930-91356952 GAGGATAAATGATAGGAACTGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117268543 14:54116610-54116632 CAGGCAGCATGATATAACCTGGG + Intergenic
1117487160 14:56209957-56209979 CAGGATTCATGATTGGATCTTGG + Intronic
1118911686 14:70066968-70066990 CAGGATGCATGATAGGACCTGGG - Intronic
1119045443 14:71314766-71314788 CAGGATGCATAACAGGAATTTGG - Intergenic
1119478540 14:74946037-74946059 CAGGAAGCATCAGTGGACCTTGG - Intronic
1120128212 14:80772520-80772542 CTGGATGCCGGACAGGACCTGGG + Intronic
1121955303 14:98207787-98207809 CAGGATGCATTATAAAGCCTGGG + Intergenic
1124484240 15:30101416-30101438 CTGGTGGCATGATAGGTCCTGGG - Intergenic
1124490623 15:30152759-30152781 CTGGTGGCATGATAGGTCCTGGG - Intergenic
1124519342 15:30395808-30395830 CTGGTGGCATGATAGGTCCTGGG + Intergenic
1124539313 15:30570413-30570435 CTGGTGGCATGATAGGTCCTGGG - Intergenic
1124752910 15:32385570-32385592 CTGGTGGCATGATAGGTCCTGGG + Intergenic
1124759337 15:32437159-32437181 CTGGTGGCATGATAGGTCCTGGG + Intergenic
1129210087 15:74063426-74063448 CTGGTGGCATGATAGGTCCTGGG + Intergenic
1129476947 15:75792005-75792027 CTGGTGGCATGATAGGTCCTGGG - Intergenic
1129891472 15:79074628-79074650 CTGGATGCATTATGGGGCCTGGG - Intronic
1130283005 15:82533528-82533550 CTGGTGGCATGATAGGTCCTGGG - Intergenic
1132283193 15:100638520-100638542 CAGTTTGGAAGATAGGACCTTGG + Intronic
1132456492 16:26521-26543 CAGGAAGCATGAGAGCACCCAGG + Intergenic
1132695507 16:1200077-1200099 CAGGGGGCATGATAGGACTGAGG - Intronic
1135758792 16:25119700-25119722 CAGGATGCCGGAAAGGCCCTGGG - Intronic
1138027522 16:53534176-53534198 CAGAATACATGTTAGGACTTTGG + Intergenic
1140229598 16:73106701-73106723 CATGATGAATGATGGGAACTTGG - Intergenic
1142686219 17:1578306-1578328 CAGGATGAAGGAGAGGATCTGGG + Exonic
1145965423 17:28913376-28913398 GAGCATTCATGATGGGACCTCGG - Intronic
1146794667 17:35772888-35772910 GAGGATGGATGATGGAACCTCGG + Intronic
1146834411 17:36098782-36098804 CAGGATGCATGTCAAGACCCAGG - Intergenic
1150725802 17:67650400-67650422 CAGGATGCCTTTTAGGAACTGGG - Intronic
1151113883 17:71710983-71711005 CAGAATTCATAATTGGACCTTGG + Intergenic
1152609376 17:81308140-81308162 CAGGGTGCCTGTGAGGACCTGGG - Intergenic
1153318691 18:3750600-3750622 CAGGACTCATGATAGGAGCATGG - Intronic
1157329827 18:46695653-46695675 CAGGAATCATGATAGGTCATAGG - Intronic
1162870041 19:13579584-13579606 CAGGAGGCATGGGAGGACCCAGG + Intronic
1163032476 19:14553569-14553591 CAGGATGGCTGAGAAGACCTAGG - Intronic
1166070588 19:40385113-40385135 AAGGATGCAGGATAGGACCAGGG - Intronic
925756998 2:7142916-7142938 CTGGCTGCCTGATAAGACCTGGG - Intergenic
925951911 2:8922726-8922748 GAGGAGGCCTGAGAGGACCTGGG - Intronic
926271661 2:11371454-11371476 CAGGACGCAGGAGAGGACTTGGG + Intergenic
930432738 2:51301482-51301504 TGGGATGCATGAAAGGACCAGGG - Intergenic
931738109 2:65216607-65216629 CAGGCTCCATTCTAGGACCTGGG - Intergenic
932064236 2:68536274-68536296 CAGGAACCATGATAAGATCTAGG + Intronic
935068459 2:99673361-99673383 CAGGATGAATGGGGGGACCTGGG - Intronic
938031056 2:127993846-127993868 CAGGAGGCTTGATTGAACCTAGG - Intronic
939502519 2:143005354-143005376 CAGGTTCCATGTTAGGACCTAGG + Intronic
941610337 2:167653874-167653896 AAGAATGCATGGTGGGACCTTGG - Intergenic
1168745978 20:240830-240852 CATGAGGCAAGAAAGGACCTGGG + Intergenic
1171238353 20:23545994-23546016 CATGATGCATGACATGACCCAGG - Intergenic
1172645885 20:36469300-36469322 CAGGATGCAGGTTAGGAGCCTGG - Intronic
1177191827 21:17860712-17860734 CATGCTGCATGATAAAACCTTGG - Intergenic
1179774068 21:43648378-43648400 CAAGATGCTTGACAGCACCTGGG - Intronic
1179944935 21:44666786-44666808 CAGGATGCCTGGCAGGAGCTGGG + Exonic
1181486005 22:23232172-23232194 CAGTAGGGATGATAGGACCCAGG + Intronic
1181572795 22:23776777-23776799 CTGGTTGCAGGCTAGGACCTTGG - Intronic
1181610214 22:24006940-24006962 CAGCCTGCATGACAGGGCCTAGG + Intergenic
1184060201 22:42076997-42077019 CAGGAGGCATGGCAGGACCTGGG - Intronic
950785816 3:15434553-15434575 CTGGATCCATGATAGCAACTTGG + Intronic
952112651 3:30142050-30142072 TAGGAAGCATGAGATGACCTTGG - Intergenic
952213050 3:31248769-31248791 AAGGATGAATGAGAGGCCCTGGG - Intergenic
952845908 3:37688043-37688065 CATGATGAATGACAGGAGCTGGG - Intronic
953334399 3:42081370-42081392 CAGTATAAATGATAGAACCTGGG + Intronic
961202874 3:125058128-125058150 CTGGATGCAGTATAGAACCTTGG + Intergenic
963006536 3:140731676-140731698 TAGGATGCATCATAGATCCTTGG + Intergenic
971697419 4:29924609-29924631 CATGTAGCATGAAAGGACCTAGG - Intergenic
977101894 4:92826562-92826584 CAGTATCCATAATAGTACCTAGG + Intronic
979225014 4:118274834-118274856 CAGCATCTATGACAGGACCTGGG + Intergenic
979716462 4:123844593-123844615 CTGGATGCCAGACAGGACCTGGG - Intergenic
980745013 4:137001452-137001474 CTGGATGCAAGACAGGAACTTGG + Intergenic
980924477 4:139120951-139120973 AAGGACACATGATAGGATCTAGG - Intronic
986431539 5:7685751-7685773 GAAGATGCGTGATAGGAGCTGGG + Intronic
990112017 5:52338133-52338155 CAGGATGCATAACAGGCCCAGGG - Intergenic
991486952 5:67147117-67147139 CAAAATGCATGGCAGGACCTAGG - Intronic
991685387 5:69177067-69177089 GAGGAAGCATGAGAGCACCTAGG + Intronic
995503835 5:112837677-112837699 CAGGAAGCATTATGGGACATGGG + Exonic
996624199 5:125550497-125550519 CAGGATGCAAGAAAGAATCTTGG - Intergenic
997356745 5:133267332-133267354 CAGGACCCATGAGAGGGCCTGGG + Intronic
997698938 5:135882793-135882815 CAGCATGCATGTCAGGACCGAGG - Intronic
998946688 5:147347544-147347566 CAGGATGCATGCTAGCATCCCGG - Intronic
1000076702 5:157795368-157795390 CAGGATCCTTGATTGGACCCCGG + Intronic
1003149915 6:3539714-3539736 CAGGATGTTTGATAGGTCTTAGG + Intergenic
1004404958 6:15324238-15324260 AAGGATGAATGATAATACCTTGG - Intronic
1006169958 6:32087037-32087059 CAGGATGGATGCCAGGACCCTGG + Intronic
1006631727 6:35435205-35435227 CAGGAGACCTGATATGACCTTGG - Intergenic
1017359652 6:153552750-153552772 CAGGGTCCAGCATAGGACCTTGG + Intergenic
1020031147 7:4933723-4933745 CAGGAGGAATGATTGGGCCTCGG - Intronic
1021343066 7:19488614-19488636 CTGGATGCAGGAAAGGAACTCGG - Intergenic
1022955487 7:35376557-35376579 CAGGACCCAAGAGAGGACCTCGG - Intergenic
1023854345 7:44172690-44172712 CAGGGTGCTTGTTAGGACCAGGG + Intronic
1027817945 7:83001980-83002002 AAAGAAGCCTGATAGGACCTGGG - Intronic
1027888340 7:83937910-83937932 CTGGATGCTGGATTGGACCTGGG + Intergenic
1030270314 7:107662240-107662262 CAGGATGCAAGCTAGAACCCAGG + Intronic
1034558443 7:151864425-151864447 GAGGATGCATGGTAGCCCCTGGG - Intronic
1037388873 8:18371540-18371562 GAGGATATATGATAGGACATCGG - Intergenic
1039748581 8:40455962-40455984 CAAGAGGCATGAAATGACCTGGG - Intergenic
1041274471 8:56142906-56142928 CTGGATGCAGGATAAGAACTTGG + Intergenic
1041392233 8:57357345-57357367 CATGATTCATGATAGCACCAAGG - Intergenic
1042445894 8:68884769-68884791 CTGGATGCTTGATAAGAGCTTGG - Intergenic
1043660909 8:82739343-82739365 CAGGATGACTGATTGAACCTAGG + Intergenic
1045254475 8:100508185-100508207 CTGGGTGCCTGATCGGACCTGGG + Intergenic
1051739721 9:20239658-20239680 CAGGATCCATCATAAGACTTGGG + Intergenic
1056327902 9:85495873-85495895 CAGGCTCCATGATAGGGTCTAGG + Intergenic
1060164076 9:121394467-121394489 CAGGAAGCATGAAATGAGCTGGG - Intergenic
1062401395 9:136374249-136374271 CAGGATGCATGTGAGGACTGAGG + Intergenic
1189595964 X:42565731-42565753 CAGGATGGAAGGTAGGACTTGGG + Intergenic
1199897087 X:152136433-152136455 CTTGATGCCTGATACGACCTGGG + Intronic
1200345681 X:155445034-155445056 CAAGATGCTTGATATGACTTCGG - Intergenic
1200399870 X:156013202-156013224 CAGGAAGCATGAGAGCACCCAGG - Intergenic