ID: 1118914992

View in Genome Browser
Species Human (GRCh38)
Location 14:70095368-70095390
Sequence TTGTGTCAATGCTAGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118914992_1118914997 4 Left 1118914992 14:70095368-70095390 CCAGTGACCTAGCATTGACACAA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1118914997 14:70095395-70095417 CAGAGACCTGGACCCCAGCCAGG 0: 1
1: 0
2: 5
3: 85
4: 620
1118914992_1118914995 -8 Left 1118914992 14:70095368-70095390 CCAGTGACCTAGCATTGACACAA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1118914995 14:70095383-70095405 TGACACAAAGGCCAGAGACCTGG 0: 1
1: 0
2: 2
3: 16
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118914992 Original CRISPR TTGTGTCAATGCTAGGTCAC TGG (reversed) Intronic
905289938 1:36914281-36914303 TTGTGTCATTGCTATTTCAGTGG + Intronic
910746213 1:90577555-90577577 TTGTGTGACTGCTAGGTACCAGG - Intergenic
910893160 1:92039249-92039271 TTGTGTCTTTGCTACATCACTGG + Intronic
911473659 1:98349646-98349668 ATGTGTCACTTCTAGGTCAGAGG + Intergenic
920380714 1:205533155-205533177 TTGGGCCAATGCCAGGCCACAGG - Intergenic
923697682 1:236269987-236270009 TTATATAAATTCTAGGTCACTGG - Exonic
924224791 1:241912601-241912623 ATGTGTCAATGTTGGTTCACAGG + Intergenic
1063745945 10:8881771-8881793 TTGTGTCAATGGTTAGTCATTGG + Intergenic
1066396084 10:35023275-35023297 TGGTTTCACTGATAGGTCACAGG + Intronic
1067076325 10:43186878-43186900 TTGTGTCAATGTGGGTTCACTGG - Intergenic
1068358623 10:55945461-55945483 TTGTATCAATACTAGCACACAGG + Intergenic
1070974430 10:80594971-80594993 TTGATTACATGCTAGGTCACTGG - Intronic
1075195974 10:120359401-120359423 TTCTGTCACTCCCAGGTCACAGG + Intergenic
1076933760 10:133553657-133553679 ATGTCTCAATGCTAGGGCACAGG - Intronic
1078076241 11:8163859-8163881 CTATGGAAATGCTAGGTCACAGG + Intronic
1078313755 11:10273577-10273599 TTTTGTCAATGCTAGGACCATGG + Intronic
1078554211 11:12305618-12305640 TTTTGTGAGAGCTAGGTCACAGG - Intronic
1080370792 11:31640057-31640079 TTGTGTCCATCCTTGGACACTGG - Intronic
1089007047 11:115100888-115100910 TTGTGTCACTGCTGGTTCAATGG + Intergenic
1093437336 12:19150689-19150711 GTGTTTAAATGCTATGTCACTGG + Intronic
1098177134 12:67804648-67804670 TTGTGTCAATATTATGGCACCGG + Intergenic
1099255032 12:80305315-80305337 TTGTATTAATGCTAAGACACTGG + Intronic
1105014749 12:132779501-132779523 TTGTGGCAAAGCCAGGTCATAGG + Intronic
1105618529 13:22044380-22044402 TTGTGTTAATGCTAAGGAACTGG + Intergenic
1107170531 13:37337416-37337438 TTGTTTCAATGCTAGGATGCAGG - Intergenic
1107671594 13:42751766-42751788 ATGTGTAAATGCTGGGTCAAAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112743512 13:102501717-102501739 TTTTGTCAATGCTATGCCACAGG - Intergenic
1118914992 14:70095368-70095390 TTGTGTCAATGCTAGGTCACTGG - Intronic
1120829918 14:88988670-88988692 TTGTATCAATGCAAGGTACCAGG - Intergenic
1124425149 15:29557177-29557199 TTGTGTTAATGCTGGGTCTCTGG + Intronic
1124553405 15:30704414-30704436 TTGTGTCAATGTTAATTCTCTGG - Intronic
1124677840 15:31701254-31701276 TTGTGTCAATGTTAATTCTCTGG + Intronic
1129126280 15:73443759-73443781 CTGTGTGAATGCTTGGTTACGGG - Intronic
1137766435 16:50981109-50981131 TTGTGTGTCTGCCAGGTCACTGG - Intergenic
1140119672 16:72072682-72072704 TTGTATTAATCCTAGGGCACAGG - Intronic
1143253091 17:5537115-5537137 TTGGGTCAATGCCAGGGCAAGGG + Intronic
1144167687 17:12628341-12628363 TTGTGGCATTGGTAGATCACAGG - Intergenic
1144204125 17:12967171-12967193 GTGTGTCAATGCCTGGACACTGG + Intronic
1146497639 17:33337176-33337198 TTCTGTCAGTGCTACCTCACTGG - Intronic
1147111967 17:38269463-38269485 TGGTGTCAAGGCCAGGTAACAGG + Intergenic
1147900929 17:43783794-43783816 TTATGTCAATGCCAGGGCATTGG - Intronic
1148417607 17:47519338-47519360 TGGTGTCAAGGCCAGGTAACAGG - Intergenic
1148897414 17:50847083-50847105 TTGTGTCAATCCTTTGTAACAGG - Intergenic
1156115652 18:33784281-33784303 CTCTGTCAGTGTTAGGTCACTGG - Intergenic
1168449004 19:56448483-56448505 GTGTGTCACTGGTATGTCACTGG - Intronic
925655559 2:6144381-6144403 TTTTGTCAACACTAAGTCACAGG - Intergenic
928954716 2:36852407-36852429 TTGTGTCAATGTTAAGTTTCCGG + Intronic
929366679 2:41166619-41166641 TTATGTGATTGCTAGGTGACAGG - Intergenic
930502495 2:52239220-52239242 TTGTGTCAAAGCTAGATTATAGG - Intergenic
931239865 2:60442450-60442472 TTGTGGCCATGGCAGGTCACAGG + Intergenic
933694467 2:85207237-85207259 TTGTGTGCATGGTAGGTCACAGG - Intronic
935349474 2:102141423-102141445 TTCTCTTAATGCTACGTCACTGG + Intronic
935946467 2:108290753-108290775 GTGTGGCAGTGCTAGGACACGGG - Intronic
946473235 2:219982433-219982455 TTGACTCCATGCTTGGTCACTGG - Intergenic
947169659 2:227298572-227298594 TTGTGGCAATGCTAAGTGAAGGG + Intronic
1169572785 20:6924644-6924666 TTGTGTCAAAGCTTGGGCTCTGG + Intergenic
1170366557 20:15604384-15604406 TTGTTTCAGTGCTTGGGCACAGG - Intronic
1179018968 21:37620610-37620632 TTGTCTCAAATCCAGGTCACAGG - Exonic
952877577 3:37959738-37959760 TTGTGGAAATGCTAGGTCAAAGG + Intronic
955526997 3:59831526-59831548 TTGTGTCAATGCTGGGGTAGAGG - Intronic
958523367 3:95220880-95220902 ATGTTTAAATGCTAGGTTACTGG - Intergenic
959608622 3:108269075-108269097 ATGTGACAATGCTAGGACACAGG + Intergenic
960740085 3:120823916-120823938 TTTTCTCAAGGCTATGTCACAGG + Intergenic
963419903 3:145048411-145048433 TTCTGTCAGTGCTCTGTCACAGG + Intergenic
964711148 3:159673140-159673162 TTGTTTCAAGGCTGTGTCACTGG - Intronic
976583083 4:86762939-86762961 TTGTCTCAAAGCCAGGTCAATGG + Exonic
977860782 4:101957343-101957365 CTGTTTCAATGGTAGGTAACAGG - Intronic
979559005 4:122081189-122081211 TTCTGTCCTTGCTAGGTCACAGG - Intergenic
986111568 5:4724169-4724191 GTGTGTCACTGCTAAGTCCCTGG + Intergenic
987323417 5:16791058-16791080 TGGTGGCAATGCCAGGTCCCTGG - Intronic
988174073 5:27697594-27697616 TTGTTTCAATGCTATCTCTCTGG + Intergenic
992561276 5:77955379-77955401 TTTTGCCAATGCTATATCACTGG - Intergenic
993031041 5:82706160-82706182 TAGTATCAATGCTATATCACAGG + Intergenic
996569302 5:124914844-124914866 TTGTGTCTCTGCCAGGTAACAGG - Intergenic
1005020418 6:21412805-21412827 TTTTGTAAATGGTAGGTTACTGG + Intergenic
1014974191 6:127858452-127858474 TTATGTCTATGATAGGTGACAGG + Intronic
1018467618 6:164065172-164065194 TAGTGTCATTGCTGGATCACAGG - Intergenic
1029300318 7:99577824-99577846 TTTTGACAATGGCAGGTCACAGG + Intronic
1038630229 8:29235190-29235212 TTGTGTCAATGCTGTTTCATTGG - Intronic
1041395361 8:57384652-57384674 TTGTGTGGATGCTTGGTCACAGG + Intergenic
1044869057 8:96600733-96600755 TTCAGTCACTGCAAGGTCACAGG + Intronic
1045815437 8:106271434-106271456 TGGTGTCAGTTCTAGGCCACAGG + Intronic
1051396430 9:16626842-16626864 TTGGCTCACTGCTGGGTCACAGG - Intronic
1055115626 9:72602194-72602216 TCATGGCAATGCTAGGACACAGG + Intronic
1062109683 9:134775054-134775076 TTGTGTGGACGCTAGGTCTCAGG + Intronic
1062474755 9:136721510-136721532 TAGTGTGAATTCTAGTTCACCGG + Intronic
1062666280 9:137674677-137674699 TTGTGCCCATGCTAGGTGCCCGG + Intronic
1191140658 X:57113427-57113449 TTGTGTCAGTGCTGGATCATTGG + Intergenic
1195658578 X:107356548-107356570 TGCTGTCAATGCTAGGTCATGGG - Intergenic
1197993356 X:132343215-132343237 TTCTGGCTTTGCTAGGTCACTGG + Intergenic
1198305825 X:135382209-135382231 TTCTGGCAATGCTAGTTAACAGG + Intergenic