ID: 1118916704

View in Genome Browser
Species Human (GRCh38)
Location 14:70113730-70113752
Sequence CAACATGCACAGATAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118916703_1118916704 -10 Left 1118916703 14:70113717-70113739 CCACAGGCTAAATCAACATGCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118916704 Original CRISPR CAACATGCACAGATAGAGCC AGG Intronic
901956057 1:12786731-12786753 CAAGATGCACACACAGGGCCGGG - Intergenic
901979436 1:13022800-13022822 CAAGATGCACACACAGGGCCAGG - Intronic
902002647 1:13206138-13206160 CAAGATGCACACACAGGGCCAGG + Intergenic
902021879 1:13351901-13351923 CAAGATGCACACACAGGGCCAGG + Intergenic
903282459 1:22257746-22257768 CCACATGCAAAGGCAGAGCCTGG - Intergenic
905731327 1:40301158-40301180 CATCAGGCCCAGACAGAGCCTGG - Exonic
908512979 1:64864182-64864204 CAACATGCAGAGAGAGCGGCTGG - Intronic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912617976 1:111125170-111125192 CAACATCCACAGCATGAGCCAGG - Intronic
920937127 1:210446023-210446045 CCATATTCAAAGATAGAGCCTGG - Intronic
921555626 1:216595455-216595477 AAACATGCACAAAAAGAACCTGG + Intronic
924021889 1:239792106-239792128 CAAGGTGCTCAGAGAGAGCCTGG - Intronic
1067270376 10:44786524-44786546 CAACATGAAGAGTTAGAGGCAGG - Intergenic
1068643695 10:59440724-59440746 CAACCTGCCAAGATTGAGCCAGG + Intergenic
1069926222 10:71852510-71852532 CAACAGGTAGAGATAGAACCTGG + Intergenic
1070740601 10:78900648-78900670 CAAGATGCACTGGCAGAGCCTGG + Intergenic
1073703872 10:105960368-105960390 CAACATGTACAGAAAAAGCCAGG - Intergenic
1073869143 10:107842102-107842124 AAACATTCAAAGAAAGAGCCTGG + Intergenic
1089404031 11:118182667-118182689 CAGCATGCACAGATTGCGGCTGG - Intergenic
1096025053 12:48352979-48353001 CACCATGCCCAGCTAGAGACAGG - Intergenic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1100277298 12:93082739-93082761 GATCATGCACAGGTAGAGCCAGG + Intergenic
1101824237 12:108208277-108208299 CAAAATGCTCAGACAGTGCCTGG - Intronic
1102707375 12:114893888-114893910 CAGCATGCCCAGCTATAGCCTGG - Intergenic
1102869593 12:116403113-116403135 GATCATGCACATAAAGAGCCTGG + Intergenic
1102935001 12:116889003-116889025 AAACCTTGACAGATAGAGCCAGG + Intergenic
1103314395 12:120040709-120040731 CAACATGGAAATATAGGGCCAGG - Intronic
1104357622 12:128101634-128101656 GACCATGCAGAGATGGAGCCAGG - Intergenic
1104591507 12:130087733-130087755 CATCATGCACTTAAAGAGCCTGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104990279 12:132620623-132620645 CCACCTGCACAGAGAGGGCCTGG + Intronic
1106181395 13:27372475-27372497 CAAGATGCACAGCTAAAGGCTGG + Intergenic
1106883700 13:34159746-34159768 CAAGATGTACTGATAGAGGCTGG + Intergenic
1107041855 13:35957284-35957306 CAACATCCTCAGATAGAGTCAGG + Intronic
1108697024 13:52911428-52911450 CATCCTGCTCAGACAGAGCCAGG - Intergenic
1110184933 13:72662334-72662356 CAATATCAACAGATAGAACCTGG - Intergenic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1113223811 13:108136670-108136692 CAACTTGCAGAGAAAGAGCAAGG + Intergenic
1115648769 14:35388306-35388328 CAGTCTCCACAGATAGAGCCAGG + Intergenic
1115824218 14:37248033-37248055 AAACATGCACACAGAGACCCAGG + Intronic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1116799868 14:49431425-49431447 TAAAATGCACAGAGAGGGCCAGG + Intergenic
1116864306 14:50018886-50018908 CAACATCCAAAGACAGAGACAGG - Intergenic
1118333580 14:64833136-64833158 GAACATGTCCAGAGAGAGCCGGG - Intronic
1118848232 14:69564549-69564571 CCCCATGCACAGTGAGAGCCAGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1119535187 14:75397092-75397114 CAAAATGCAGAGATACTGCCTGG + Intergenic
1120231990 14:81850078-81850100 CAAAATGCACAAACAAAGCCAGG + Intergenic
1120607472 14:86596842-86596864 CAAAGTTCACAGATACAGCCAGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1122099360 14:99394874-99394896 CAAAAGGCACAGCTAGGGCCAGG - Intergenic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1126043574 15:44617153-44617175 CACCCAGCACAGAGAGAGCCAGG - Intronic
1127011561 15:54636286-54636308 AGACATGCACAGTGAGAGCCTGG - Intergenic
1128347020 15:66860793-66860815 CAACAGGGACAGAGAGAGCGAGG + Intergenic
1131959751 15:97777063-97777085 CAACCTGCCTAGATAGAACCAGG + Intergenic
1133224543 16:4334667-4334689 CCACATGCACAGGTAGGGGCTGG + Intronic
1133714973 16:8439264-8439286 CAACTTGGACAGACAGAGCAGGG - Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135012323 16:18892999-18893021 CAACATGCAGGTAAAGAGCCCGG + Intronic
1135177793 16:20246327-20246349 CCACATGCTCAGATGGAGCCAGG - Intergenic
1135319185 16:21480242-21480264 CAACATGCAGGTAAAGAGCCCGG + Intergenic
1135372081 16:21912035-21912057 CAACATGCAGGTAAAGAGCCCGG + Intergenic
1135439705 16:22458669-22458691 CAACATGCAGGTAAAGAGCCCGG - Intergenic
1136329485 16:29562315-29562337 CAACATGCAGGTAAAGAGCCTGG + Intergenic
1136444113 16:30302022-30302044 CAACATGCAGGTAAAGAGCCTGG + Intergenic
1137228955 16:46543537-46543559 CATCATATACAGATAGAACCAGG + Intergenic
1138986675 16:62337447-62337469 AAACCTGCACAGGTAGGGCCAGG + Intergenic
1140115044 16:72034608-72034630 CAAAATGCACAAACAGAGCAAGG - Intergenic
1140137067 16:72216121-72216143 CAACAAGCAAAGAAAGAGCAAGG - Intergenic
1140924047 16:79565996-79566018 CACCCTGCACTGATAGACCCTGG + Intergenic
1143975208 17:10824414-10824436 CTAGATGCAGAGATAGAGGCAGG + Exonic
1148406199 17:47419028-47419050 CATCATATACAGATAGAACCAGG - Intronic
1148645274 17:49216619-49216641 CAACATGCGCAGAGTGTGCCCGG - Exonic
1151526174 17:74670354-74670376 CAACATGGAAGGAAAGAGCCAGG - Intergenic
1160038096 18:75319850-75319872 GAACATGCAAAGACAGAGTCGGG - Intergenic
1160180611 18:76632094-76632116 CAACATGAACACATAGACACAGG - Intergenic
1163747035 19:19054797-19054819 CCACTTGCACAGAAAGAGGCTGG - Intronic
1164251278 19:23478185-23478207 CAACCTCCCAAGATAGAGCCAGG + Intergenic
1164288515 19:23844976-23844998 CAACCTCCCAAGATAGAGCCAGG - Intergenic
1164511812 19:28903808-28903830 CAACATGCATTCATTGAGCCAGG + Intergenic
1167836533 19:52076489-52076511 CACCATGCCCAGGTAGAGACAGG - Intronic
1168428108 19:56255779-56255801 CAACGGGCAGAAATAGAGCCAGG - Intronic
925956903 2:8975457-8975479 TGAAAGGCACAGATAGAGCCAGG - Intronic
927155122 2:20216896-20216918 GAAGATCCACAGAGAGAGCCAGG + Intronic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
930471556 2:51821883-51821905 TAACATACAGTGATAGAGCCAGG - Intergenic
931459969 2:62442049-62442071 CCACATGCACAGCCAGAGCCTGG - Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
935508416 2:103937758-103937780 CAGCAGGCACAGATAGATTCAGG + Intergenic
935532902 2:104256970-104256992 CAACCTGCCAAGATAGAACCAGG + Intergenic
935660331 2:105461206-105461228 CAACATGTACAGATTGATCCTGG - Intergenic
936606851 2:113967088-113967110 CATCACACACAGATAAAGCCAGG + Intergenic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
938621121 2:133054464-133054486 CAACATGCCAAGAGGGAGCCTGG + Intronic
938954012 2:136282059-136282081 CACCTTGCACCGATAGAGCCCGG - Intergenic
939257830 2:139767433-139767455 GAATATGCACATATAGGGCCAGG + Intergenic
941970641 2:171347199-171347221 AAACTTGCACAGAAAGAGACTGG + Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
942682323 2:178490462-178490484 CAACATTCTCATATAGACCCGGG - Intronic
944075279 2:195722653-195722675 AAGCATGGGCAGATAGAGCCAGG + Intronic
945035306 2:205699349-205699371 CATAATGTACAGAGAGAGCCTGG + Intronic
945075831 2:206038670-206038692 CAAAATGCAAAAATATAGCCAGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
948163017 2:235840619-235840641 CAGCATTCCCAGAGAGAGCCTGG + Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1172671007 20:36634442-36634464 GAATATGCACTAATAGAGCCAGG - Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173333911 20:42097994-42098016 CAGCCTGTACAGACAGAGCCTGG - Intronic
1175656157 20:60772836-60772858 CCTCATGCCCAGATAGAGCTGGG - Intergenic
1176844097 21:13863294-13863316 AAAGATGCACAGGTACAGCCTGG - Intergenic
1179045616 21:37842641-37842663 CAACATGCAGAGAAACAGCATGG + Intronic
1179172059 21:38980600-38980622 CCACATCCACAAACAGAGCCTGG - Intergenic
1179955078 21:44734047-44734069 CAACATGCAAAAATAGATCTTGG + Intergenic
1181883864 22:26003355-26003377 CAAACTGGACAGAGAGAGCCAGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185125242 22:49006930-49006952 CAACCACCACAGAAAGAGCCAGG - Intergenic
949775283 3:7625744-7625766 CAACCTGCACCTATAAAGCCAGG - Intronic
950882735 3:16336266-16336288 CAAGTGGCACAGACAGAGCCAGG - Intronic
950962467 3:17120309-17120331 CAACATGCAAAGATTGGGCATGG - Intergenic
952025808 3:29080506-29080528 GAAGATGCACAGCTAGAGGCTGG + Intergenic
955385226 3:58474116-58474138 CAACATACAGAGATAGAACAGGG + Intergenic
956697166 3:71928518-71928540 CAACATTTACACATAGGGCCTGG - Intergenic
957980389 3:87501976-87501998 CACCATGCCCAGGTAGAGACAGG - Intergenic
960221531 3:115116261-115116283 TAATATGCCCAGATAGAGCTGGG - Intronic
961788243 3:129360269-129360291 CAATCTACACAGATAAAGCCAGG - Intergenic
964203487 3:154144646-154144668 CACCATCTACAGACAGAGCCAGG - Intronic
964321330 3:155500848-155500870 CAACATGCAGAGAATGAGCTGGG + Intronic
964826134 3:160829937-160829959 CAACTTGCAAAGGTACAGCCTGG + Intronic
964828764 3:160859737-160859759 CAAAATGCACATATTGACCCAGG - Intronic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
970063990 4:12070094-12070116 CAACATGCACAGATACCCACTGG + Intergenic
970614090 4:17751649-17751671 AAACAGGCTCAGATAGAACCAGG - Intronic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
978353830 4:107849098-107849120 CAACATGCAGAGAAACAGACTGG + Intronic
985574324 5:666491-666513 CAACACACACAGGCAGAGCCGGG - Intronic
992617795 5:78562036-78562058 AAAGAGGCACAGAAAGAGCCTGG + Intronic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
995346894 5:111131837-111131859 CAAAGTGCCCAGAGAGAGCCAGG + Intergenic
995513884 5:112935326-112935348 CACCATTCACAGATAAGGCCAGG + Intergenic
996493543 5:124127341-124127363 CAACATGCAGAGCTATAGCCAGG + Intergenic
996778809 5:127160861-127160883 AAGCATGCACAGAGAGACCCAGG - Intergenic
996919488 5:128750844-128750866 CAGCGTCCACAGATAGAGACTGG - Intronic
997673611 5:135696111-135696133 ACACATGCACAGAAAGTGCCTGG + Intergenic
997882607 5:137603890-137603912 TAACATTAACAGAAAGAGCCTGG + Intergenic
998720260 5:144938096-144938118 CAACTTCCAAAGATTGAGCCAGG + Intergenic
999114935 5:149154382-149154404 CAACTGGCAGAGACAGAGCCTGG + Intronic
1001581658 5:172802631-172802653 CACCATGCCCAGCTAGAACCAGG + Intergenic
1005097916 6:22138666-22138688 GAACATGCACAGAGAAAGGCTGG + Intergenic
1005435157 6:25801954-25801976 GAACATCCACAGGTAGAGCTTGG + Intronic
1005814257 6:29538192-29538214 CCACATGCAAAGAAAGGGCCAGG + Intergenic
1006431248 6:33998141-33998163 CAACATGCACAAACAAAGCAAGG + Intergenic
1008129199 6:47701318-47701340 AATCATGCACAGAAAGAGGCGGG + Intronic
1012281376 6:97331494-97331516 CAATATGCACAGATAGTTCATGG - Intergenic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1022513736 7:30962150-30962172 GAACATGTACAGTTAGAGCAGGG + Intronic
1031880057 7:127187642-127187664 AATCATGCAGAGAAAGAGCCAGG - Intronic
1032670503 7:134078015-134078037 CAACAGGCACAGCCAGATCCAGG - Intergenic
1035406545 7:158602359-158602381 CAACAAGGACAGAAAGACCCCGG + Intergenic
1038197926 8:25385101-25385123 CAGCAGGCACAGAGAGAGCTGGG + Intronic
1038443617 8:27588100-27588122 CACCATGCCCAGCTAGAGACAGG - Intergenic
1039571996 8:38594192-38594214 CAAGAAGCACAGAGAGGGCCGGG + Intergenic
1039809791 8:41036457-41036479 TACCAAGCACAGATAGTGCCTGG + Intergenic
1041390531 8:57343649-57343671 CAGCCTGCCCAGAGAGAGCCTGG + Intergenic
1042215465 8:66426598-66426620 ACACATGCACACAAAGAGCCAGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044310615 8:90687863-90687885 CAAAATGCACAAACAGAGCAAGG - Intronic
1048378165 8:133840780-133840802 AAACCTGCACAGAGACAGCCAGG - Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1051543005 9:18241799-18241821 CAACATACAAAGATAGAATCAGG + Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1060516389 9:124268580-124268602 CAGCAAGCAGAGAGAGAGCCAGG - Intronic
1060723451 9:125992930-125992952 CATTATCCACAGAGAGAGCCAGG - Intergenic
1062084916 9:134643502-134643524 CAACAAGCACTGATCGTGCCAGG - Intronic
1062164748 9:135101985-135102007 CCATAAGCACAGACAGAGCCTGG + Intronic
1187677039 X:21726594-21726616 CAACAGGCACCGATAGTTCCAGG - Intronic
1193267655 X:79492263-79492285 CAACATACAAAGATTGAACCAGG + Intergenic
1194612911 X:96065141-96065163 CAACCTACACAGATTGAACCAGG - Intergenic
1200096324 X:153665799-153665821 CCACATGCCCAGACAGTGCCTGG + Intergenic