ID: 1118920085

View in Genome Browser
Species Human (GRCh38)
Location 14:70142073-70142095
Sequence AGTGCAGCCCCATGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118920077_1118920085 17 Left 1118920077 14:70142033-70142055 CCAATGGGTTCCACGGAGCCAAG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1118920079_1118920085 7 Left 1118920079 14:70142043-70142065 CCACGGAGCCAAGCCTGGCACCT 0: 1
1: 0
2: 2
3: 29
4: 274
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1118920074_1118920085 26 Left 1118920074 14:70142024-70142046 CCCAGCTGGCCAATGGGTTCCAC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1118920075_1118920085 25 Left 1118920075 14:70142025-70142047 CCAGCTGGCCAATGGGTTCCACG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1118920081_1118920085 -1 Left 1118920081 14:70142051-70142073 CCAAGCCTGGCACCTAATGGCCA 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1118920082_1118920085 -6 Left 1118920082 14:70142056-70142078 CCTGGCACCTAATGGCCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118920085 Original CRISPR AGTGCAGCCCCATGTGAGCC AGG Intronic
900369648 1:2325940-2325962 TGTGAAGCCCCAGGTGTGCCGGG + Intronic
901021205 1:6256909-6256931 AGTGCAGCCTGATGTAAGCCAGG - Intronic
901673980 1:10872218-10872240 AGTGCTGCCCCATGGCTGCCTGG - Intergenic
902617649 1:17632554-17632576 AGTGGGACCCCATGTGAGCTTGG + Intronic
902808435 1:18874992-18875014 AGTTTAGCCTCATGTGACCCAGG + Intronic
904367933 1:30028544-30028566 TGTGCTGCCACATGTGAGCTGGG - Intergenic
905970931 1:42141935-42141957 AGAGCAGCCCCATGAGAAACAGG + Intergenic
908640337 1:66215849-66215871 AGTGTAGCCCCTTGTGAGATGGG - Intronic
910001121 1:82343451-82343473 AATACAGCCACATGGGAGCCAGG - Intergenic
910451187 1:87347345-87347367 AGAGCATCCCCATTAGAGCCGGG - Exonic
911819903 1:102404705-102404727 AAGGCAGCCCCCTGTAAGCCAGG + Intergenic
915138315 1:153749612-153749634 TGTGCAGCCACATCTGGGCCTGG + Intronic
918107880 1:181428857-181428879 TGAGCAACCCTATGTGAGCCTGG - Intronic
919837618 1:201586567-201586589 AAGGCAGCCACCTGTGAGCCAGG - Intergenic
922776056 1:228214680-228214702 AGAGCAGCCCCAAGAGAGCTGGG + Intronic
1063189241 10:3678502-3678524 AGGGCAGCCCCTGGTGACCCAGG + Intergenic
1063419527 10:5900514-5900536 GGTGCAACCCCATGAGCGCCAGG - Intronic
1065216449 10:23453579-23453601 AGTGCAGCCTTATTTGAACCTGG - Intergenic
1065579122 10:27154168-27154190 GGTGCAACCCCAGGTAAGCCAGG - Exonic
1070046968 10:72847769-72847791 GGTGCAGCCCCATGTCAGTCAGG + Intronic
1070147939 10:73788339-73788361 AGTGCTGAGCCATGTGAGCAGGG + Intronic
1070770998 10:79082302-79082324 AAGGCAGCCCCATATAAGCCAGG - Intronic
1078069775 11:8100798-8100820 AGGGCAGCCTCACCTGAGCCAGG - Intronic
1078509851 11:11977091-11977113 GGAGCAGCCCCAGGCGAGCCAGG - Intronic
1081663951 11:44905641-44905663 AGTGCAGCCCCGGCTGTGCCTGG + Intronic
1082277369 11:50236614-50236636 AGTGTTTCACCATGTGAGCCTGG - Intergenic
1083160694 11:60852510-60852532 AGTGCCGCCCTACGTGGGCCGGG + Exonic
1083985749 11:66214090-66214112 GGTGCAGCTCCCTGTGTGCCAGG + Intronic
1084145683 11:67264009-67264031 AGCACAGCCACATGTCAGCCAGG - Intergenic
1084317526 11:68354047-68354069 ACTGCAGCCCCTTGTCAGGCTGG - Intronic
1089584259 11:119500154-119500176 ACTGCAGCCTCAAGTGAGCCAGG - Intergenic
1090199890 11:124846413-124846435 AGTGGAGACACATGTGTGCCGGG - Intergenic
1091974965 12:4817085-4817107 AGTCAAAACCCATGTGAGCCAGG - Intronic
1094478730 12:30863119-30863141 CCAGCAGCCCCAAGTGAGCCAGG - Intergenic
1095390575 12:41701280-41701302 AGTCCAGCCCCAACTCAGCCAGG + Intergenic
1095572761 12:43701311-43701333 AGAGCAGGCCCATGGGATCCTGG - Intergenic
1098341653 12:69457684-69457706 AAGGCAGCCTCATGGGAGCCAGG - Intergenic
1101835213 12:108290252-108290274 TCTGCAGCCTCATTTGAGCCAGG + Exonic
1102122367 12:110451605-110451627 ATGGCAGCCCCACGTGAGCAAGG + Intergenic
1102600437 12:114025642-114025664 ATTGCAGCCTCATGAGACCCTGG + Intergenic
1103050636 12:117776468-117776490 AGTCTGGCCCCATGTGAGTCTGG - Intronic
1103122054 12:118388762-118388784 AGTGAAGCCCCAGGTGTCCCTGG + Intronic
1104761339 12:131299058-131299080 AGCGCAGCCCCAGGTGGGCAGGG + Intergenic
1104818436 12:131661734-131661756 AGCGCAGCCCCAGGTGGGCAGGG - Intergenic
1104994582 12:132645454-132645476 AGTGCAGCTCGTAGTGAGCCTGG - Intronic
1106397646 13:29396756-29396778 TGTTCAGCCCACTGTGAGCCAGG + Intronic
1107260696 13:38487343-38487365 ACTGCAGCCTCATGAGACCCTGG - Intergenic
1113699039 13:112369657-112369679 GGTGCAGCCCCCAGTCAGCCGGG + Intergenic
1114459918 14:22879776-22879798 AGTGAAGCCCCAAGCTAGCCGGG + Exonic
1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG + Intronic
1119844673 14:77819925-77819947 AGTGCCCTCCCCTGTGAGCCAGG - Intronic
1120881819 14:89419597-89419619 TCTGCAGCCCCATCTGAGCATGG + Intronic
1122715497 14:103694437-103694459 AGTGAAACGCCATGTTAGCCAGG - Intergenic
1123068073 14:105628123-105628145 AGAGCAGCCACAGGTGAGCAGGG - Intergenic
1123071978 14:105646457-105646479 AGAGCAGCCACAGGTGAGCAGGG - Intergenic
1123072024 14:105646665-105646687 AGAGCAGCCACAGGTGAGCAGGG - Intergenic
1123091664 14:105744812-105744834 AGAGCAGCCGCAGGTGAGCAGGG - Intergenic
1123091689 14:105744891-105744913 AGAGCAGCCGCAGGTGAGCAGGG - Intergenic
1123091714 14:105744970-105744992 AGAGCAGCCGCAGGTGAGCAGGG - Intergenic
1123091805 14:105745286-105745308 AGAGCAGCCGCAGGTGAGCAGGG - Intergenic
1123091935 14:105745800-105745822 AGAGCAGCCACAGGTGAGCAGGG - Intergenic
1123092076 14:105746349-105746371 AGAGCAGCCGCAGGTGAGCACGG - Intergenic
1123092139 14:105746582-105746604 AGAGCAGCCTCAGGTGAGCAGGG - Intergenic
1123097392 14:105773004-105773026 AGAGCAGCCACAGGTGAGCAGGG - Intergenic
1123097567 14:105773710-105773732 AGAGCAGCCTCAGGTGAGCAGGG - Intergenic
1123097651 14:105774026-105774048 AGTGTAGCCACAGGTGAGCAGGG - Intergenic
1123500470 15:20877418-20877440 AATGGAGTCCCATGTGACCCTGG + Intergenic
1123557715 15:21451111-21451133 AATGGAGTCCCATGTGACCCTGG + Intergenic
1123593942 15:21888392-21888414 AATGGAGTCCCATGTGACCCTGG + Intergenic
1127628292 15:60801653-60801675 AGTGCAGCCGCCTGAAAGCCCGG + Intronic
1129236292 15:74225673-74225695 AGTGCAGCACCAGGTGAGAAAGG + Intergenic
1129701715 15:77772120-77772142 AGTGCAGCCACAGGTGCTCCAGG + Intronic
1129825927 15:78634969-78634991 AGTGCAGCACCTATTGAGCCAGG - Intronic
1131614349 15:93998858-93998880 AGTTCAGCCGCTTGTGAGCAAGG - Intergenic
1132279612 15:100602052-100602074 AGTGCGGCCAAATGAGAGCCTGG - Intronic
1202966067 15_KI270727v1_random:178283-178305 AATGGAGTCCCATGTGACCCTGG + Intergenic
1132696459 16:1204303-1204325 AGGGCAGCCCCGGGCGAGCCAGG + Exonic
1132744168 16:1429814-1429836 AGAGCAGCCCCAAGTGGCCCAGG - Intergenic
1133557829 16:6922634-6922656 TGTGCAGCCACCTGTAAGCCAGG + Intronic
1134613484 16:15630229-15630251 AGAACAGCCCCATCTGGGCCTGG + Intronic
1139527534 16:67526091-67526113 ACTGCAGCGCCATCTGTGCCTGG + Intronic
1142106072 16:88303494-88303516 AGTGGAGTTCCATGGGAGCCAGG - Intergenic
1142229614 16:88893728-88893750 ATAGCAGCCCCATGTCTGCCAGG - Intronic
1142269085 16:89079803-89079825 GGTGAGGCCCCACGTGAGCCAGG - Intergenic
1142288890 16:89183680-89183702 GGTGCAGTCCCAGGTGAGACAGG + Exonic
1143347405 17:6260033-6260055 AATGAAGCCGCAGGTGAGCCAGG + Intergenic
1143360145 17:6362921-6362943 AGAAAAGCCCCATGTAAGCCGGG + Intergenic
1143623302 17:8093452-8093474 AGTGCAGGCCCCTTTGACCCTGG - Intergenic
1145904794 17:28510159-28510181 AGTGCATCCTCCTGTGAGCATGG - Intronic
1146945438 17:36870117-36870139 AGAGCAGCCCCAGGGGAGCTGGG + Intergenic
1147251332 17:39154205-39154227 AGCGCACCCCCAGGTCAGCCTGG - Intronic
1152922287 17:83072172-83072194 ACTGGAGTCCCTTGTGAGCCTGG + Intergenic
1153781682 18:8500386-8500408 AGTCCAGCCACATCTGAGCCAGG - Intergenic
1154331029 18:13429111-13429133 AGTGCAGTGCCATGTGCGTCGGG + Intronic
1157003815 18:43558980-43559002 GGTGCAGCCCCATGTTTGCCAGG - Intergenic
1158624790 18:59061776-59061798 ACTGCAGGCCCATTTGGGCCAGG + Intergenic
1159336922 18:67080570-67080592 AGGGCAGCCCCATGGAAACCAGG + Intergenic
1160216055 18:76932666-76932688 AGTGCAGCCTCATGTCTTCCTGG + Intronic
1160364704 18:78314113-78314135 AGTGCAGGCCCTTCTCAGCCTGG + Intergenic
1161152556 19:2717204-2717226 AATGCACCCTCATGTGAGCCCGG - Exonic
1162066490 19:8128995-8129017 TGTGCAAACCCACGTGAGCCCGG + Intronic
1163056047 19:14719001-14719023 AGAGAAGCCCTATGTGTGCCAGG + Exonic
1163114659 19:15181566-15181588 ACTGCAGCCCCAGGTGGGCGGGG - Exonic
1163290030 19:16373222-16373244 AATGCGACCCCCTGTGAGCCTGG - Intronic
1163364657 19:16869254-16869276 TGTGCAGCCCCATGTGCTCCTGG - Intronic
1164532082 19:29056439-29056461 ATGGCAGCCTCATGGGAGCCTGG + Intergenic
1164893208 19:31842894-31842916 AGTGAAGCCCCATGTCTCCCTGG + Intergenic
1165474672 19:36023760-36023782 AGTGGAGCCCCATGACAGCAGGG + Intronic
926388648 2:12364115-12364137 AGAGCAGGCCCTTGTGACCCTGG + Intergenic
929244093 2:39683398-39683420 AGGAGAGCCCCATGTGAGACTGG - Intronic
929588484 2:43130657-43130679 AGGGCTGCCCCATCTGAGCCTGG + Intergenic
929805088 2:45138198-45138220 AGTGCAGGCCCATCTGAGGGCGG + Intergenic
931850010 2:66243600-66243622 AGTGAAACACAATGTGAGCCAGG + Intergenic
931850953 2:66249974-66249996 AGTGAAACACAATGTGAGCCAGG + Intergenic
932366107 2:71154508-71154530 AGTGCAGCGCCTACTGAGCCAGG - Intergenic
932750800 2:74370526-74370548 GATGCAGCGCCATCTGAGCCTGG + Exonic
935710760 2:105896270-105896292 AGGGCAGCCCCATTTGACTCGGG - Intergenic
936006947 2:108897568-108897590 AGCCCAGCCCCATGGGAGACAGG - Intronic
939959599 2:148554638-148554660 AGAGCAGCCACATGGTAGCCTGG - Intergenic
942141687 2:172983807-172983829 AGAGCAGCCCCATGTGAGTAGGG + Intronic
943577041 2:189642060-189642082 AGTGCAGCCACATATGAACAAGG + Intergenic
945499656 2:210555769-210555791 AGTGAGGCCCCTTGAGAGCCTGG + Intronic
945995712 2:216434259-216434281 AGTGTCACCCCATGTGAGGCAGG + Intronic
948199389 2:236119128-236119150 CGGGCAGCCCCATCTCAGCCAGG + Intronic
948878119 2:240840966-240840988 AGTGCAGCCACATAGGTGCCTGG + Intergenic
1169570015 20:6896194-6896216 AGTGAAGCCTCCTGTGAGCATGG + Intergenic
1170712817 20:18807672-18807694 AGTGCAGCCAGCTGGGAGCCAGG - Intergenic
1172001118 20:31777964-31777986 AGGGTATCCCCATGTTAGCCAGG + Intronic
1174033524 20:47650670-47650692 AGTGCTTCACCATGTTAGCCAGG - Intronic
1174071814 20:47904921-47904943 AGACCACCCCCATGTGAGGCTGG + Intergenic
1174663150 20:52233117-52233139 AGTGCTTCACCATGTTAGCCAGG + Intergenic
1175766202 20:61594406-61594428 AGGGCAGACCCAGGTGGGCCCGG - Intronic
1175785415 20:61708717-61708739 AGCGCCGCCTCATGTGAGGCTGG - Intronic
1180725347 22:17942743-17942765 TGGGCAGCACCAGGTGAGCCAGG + Intronic
1181013215 22:20054211-20054233 TGTGCAGACCCATGTGGGGCAGG - Intronic
1181128137 22:20713647-20713669 AGTGAAGACCCAGGTGTGCCTGG + Intronic
1184671327 22:46013607-46013629 AGGGCAGCCCCTGGTGAGTCAGG + Intergenic
1184881103 22:47304622-47304644 AGCCCAGACCCAGGTGAGCCCGG + Intergenic
950551394 3:13668371-13668393 AGTTCCACCCCACGTGAGCCAGG - Intergenic
950825368 3:15813313-15813335 AGTGCAGCGGCATGTGATCAGGG - Intronic
951742298 3:25937972-25937994 AGTGCTGACCAATGGGAGCCAGG + Intergenic
952897371 3:38086625-38086647 AATGCAGTCACATTTGAGCCAGG - Intronic
954106904 3:48414453-48414475 AGCGCATGTCCATGTGAGCCAGG + Intronic
954713045 3:52514376-52514398 AGTGCGGCACCATGTGGTCCTGG + Exonic
957042126 3:75343731-75343753 AGTGTGGCCCCATTTGAGCTGGG - Intergenic
960458520 3:117903454-117903476 TGTGCAGCCCCAGGGGAGCATGG + Intergenic
961273679 3:125709845-125709867 AGTGAAGCCCAATTTGAACCAGG + Intergenic
963088891 3:141463721-141463743 AGAGCACACCCACGTGAGCCTGG + Intergenic
965135005 3:164753567-164753589 AAAGCAGCCTCAGGTGAGCCTGG - Intergenic
966308306 3:178563124-178563146 AGTGTAGACCCTTGTGAGCCTGG + Intronic
967322887 3:188211869-188211891 AGTGAAACTCCATGTCAGCCTGG - Intronic
968414229 4:415956-415978 ACTGCATCCCCATGTGTGCCTGG - Intergenic
968446380 4:654303-654325 AGTGCAGCAGCAGGGGAGCCTGG - Intronic
968641284 4:1716362-1716384 CGTGCATCCCCTTCTGAGCCTGG + Exonic
969103964 4:4791186-4791208 ATTGCACCCCCATGTGTGCCAGG + Intergenic
970034958 4:11722810-11722832 AGTGCAGAAGCAAGTGAGCCTGG - Intergenic
975527179 4:75363507-75363529 AGTACTGCCACATGAGAGCCAGG + Intergenic
975531025 4:75399526-75399548 ATTGGAGCCCCATGTGTGGCTGG + Intergenic
976772877 4:88673478-88673500 AGTGCAGCCCCGTTTCAGGCAGG + Intronic
978762665 4:112371362-112371384 TGTGCAGGCCTATGTGTGCCTGG - Intronic
980806001 4:137814329-137814351 AGGGCAGACCCAGTTGAGCCTGG - Intergenic
982182533 4:152763046-152763068 AGTACAGCCCCATGTTGGCCAGG + Intronic
986043275 5:4013294-4013316 AGCGCTGCCCCAGCTGAGCCAGG - Intergenic
987015111 5:13810218-13810240 ACAGCCGCCCCAGGTGAGCCTGG + Exonic
989578407 5:43010126-43010148 AGTCCAGCCCCCGGTGATCCCGG + Intergenic
993509758 5:88757044-88757066 AGTGCAGCCCTATGAGAACAGGG + Intronic
996597803 5:125225718-125225740 AATGGAGCCCCAGGTGAGCAGGG - Intergenic
997381329 5:133440423-133440445 AGTGCAGCCCCACATTAGGCTGG - Intronic
997673725 5:135696836-135696858 AGTGCAGCCACAGGGGAGCTGGG + Intergenic
999500168 5:152138970-152138992 GGGGCAGCTGCATGTGAGCCAGG + Intergenic
1001273146 5:170331013-170331035 ATAGCTGCCCCATGTGAGTCGGG - Intergenic
1002125061 5:177036836-177036858 AGAGCAGCCTCACCTGAGCCTGG + Intronic
1002165173 5:177339434-177339456 AGGGCACCACCATGTGAGCTGGG + Intronic
1002816643 6:687254-687276 ACTGCAGCCTCAGGTGATCCAGG + Intronic
1003560549 6:7176377-7176399 AGGGCAGCACCATGTGAGAATGG - Intronic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1008049017 6:46881072-46881094 AGTGCAGCCCTCTGTCATCCCGG - Intronic
1009466012 6:63970257-63970279 AGTGAAGGCCCTTGTGAGCAAGG + Intronic
1010840130 6:80639264-80639286 AATGCTGCCCCATGGGAGCCTGG + Intergenic
1012070476 6:94607456-94607478 TGTGCACCCCCTTGTGAGGCAGG - Intergenic
1013234151 6:108182437-108182459 AGTGCAGTGGCATGTGAGCATGG + Intronic
1013377150 6:109528677-109528699 AGTGCAACCACATGTCACCCTGG - Intronic
1015294648 6:131576790-131576812 AGAGCAGGCCCCTGTGAACCTGG + Intronic
1016932235 6:149422754-149422776 AGTCCAGGCCCAGGGGAGCCAGG - Intergenic
1019506002 7:1391732-1391754 ACTGCAGCCTCATGAGAGCCTGG - Intergenic
1019852772 7:3575937-3575959 TGTTCTTCCCCATGTGAGCCAGG + Intronic
1021200803 7:17726883-17726905 AGTGCAGCCCCAGGGAAGCAGGG - Intergenic
1022838340 7:34137960-34137982 AGTGCAGCTCCATTAGCGCCAGG - Intronic
1025021711 7:55485632-55485654 AGTGCAGCCACAGGACAGCCGGG - Intronic
1032928385 7:136636685-136636707 AGGGCAATCACATGTGAGCCAGG - Intergenic
1034945999 7:155262421-155262443 AATGCATCTCCATGTGGGCCTGG + Intergenic
1035653761 8:1289727-1289749 TGTGCAACCCCAGGAGAGCCCGG + Intergenic
1036614456 8:10377895-10377917 AGTGCAGGCCCCCGTGATCCAGG + Intronic
1037995628 8:23350385-23350407 AGTAGAGCCCCATGTTGGCCAGG - Intronic
1038422190 8:27440429-27440451 TGTGCAGCCTCAGGTGAGCATGG + Exonic
1038708907 8:29922406-29922428 ACTTCACACCCATGTGAGCCAGG - Intergenic
1040907316 8:52481612-52481634 AGTGGTGCCCAATGTGAGCTGGG - Intergenic
1044938745 8:97319103-97319125 TGTGTATCCACATGTGAGCCAGG + Intergenic
1044938863 8:97320023-97320045 TGTGTATCCACATGTGAGCCAGG + Intergenic
1045378871 8:101602945-101602967 ACTGCAGCCCCATGAGGACCAGG - Intronic
1047628580 8:126681508-126681530 TGTGCAGCCACATCTGTGCCTGG + Intergenic
1048941030 8:139401023-139401045 AGAGCAGCCACATGTGACTCAGG + Intergenic
1049283453 8:141762238-141762260 AGTCCAGCCCCTTCTGAGGCTGG + Intergenic
1049411844 8:142477064-142477086 ACTGCAGCCCCATGGGCGGCAGG + Intronic
1049740331 8:144237401-144237423 CGGGCAGCCCCAGGTGAGCTGGG - Intronic
1052633647 9:31071982-31072004 AGGGCAGCCTCATGTGCACCCGG + Intergenic
1053293436 9:36897112-36897134 ACTGCTGCCTCCTGTGAGCCTGG + Intronic
1056112465 9:83409150-83409172 AATGCAGCCCCATTTGAGGTGGG + Intronic
1056779010 9:89535575-89535597 AGCGCAGCCCCAAGTGTGCCAGG - Intergenic
1057490302 9:95515646-95515668 AGTGCGGCCTCAGGGGAGCCCGG - Intronic
1057843228 9:98502707-98502729 GGTGCAGCCCCCAGTCAGCCTGG + Intronic
1058185010 9:101844766-101844788 AGTGCAGACCCATGTGGGCAAGG - Intergenic
1058695754 9:107557878-107557900 AGTGCAGCTCTAAGTGGGCCTGG - Intergenic
1059540665 9:115127181-115127203 AGTTGAGCCCAATGTGGGCCTGG - Intergenic
1061781755 9:133000233-133000255 AGTGCAGCCACAGGGCAGCCTGG + Intergenic
1062454732 9:136630103-136630125 AGGACAGGCCCATGGGAGCCAGG - Intergenic
1186370872 X:8946240-8946262 AATGCAGCACCATGTAAGCTTGG + Intergenic
1201395086 Y:13539319-13539341 AGTGCAGCCCCAGGTGTCCTGGG + Intergenic