ID: 1118922998

View in Genome Browser
Species Human (GRCh38)
Location 14:70167110-70167132
Sequence GTGGACTACAAAACAGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118922998_1118923004 23 Left 1118922998 14:70167110-70167132 CCATCCTCTGTTTTGTAGTCCAC 0: 1
1: 0
2: 0
3: 32
4: 280
Right 1118923004 14:70167156-70167178 CCCCTTTCCTCACCACTGTCAGG 0: 1
1: 0
2: 3
3: 27
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118922998 Original CRISPR GTGGACTACAAAACAGAGGA TGG (reversed) Exonic
900481053 1:2899504-2899526 GTGGACAACAAAACAGACCATGG + Intergenic
903391891 1:22970454-22970476 GTAGACTACAAAAGAGCAGAAGG + Intergenic
903412169 1:23154178-23154200 GTAGACTACAAAAGAGCAGAAGG + Intronic
903870166 1:26428289-26428311 GGGGAATACAAAAGAAAGGATGG - Exonic
906631246 1:47370216-47370238 GTGGGTTAAAAAACAGAGAAAGG - Intronic
906888156 1:49675407-49675429 GGGGACTCCAAAAGTGAGGAGGG + Intronic
908037571 1:60072991-60073013 CTGTACTACAAGACATAGGATGG + Intronic
908320349 1:62972474-62972496 GAGGGCTACAAAACCGAGGCTGG + Intergenic
908412726 1:63883434-63883456 GTGGCCCAGAAAACAGAGGAAGG - Intronic
910042447 1:82869048-82869070 GTAGAAAAGAAAACAGAGGAAGG + Intergenic
912802989 1:112732977-112732999 ATGGACTCCAGAACAGAGGAAGG + Intergenic
913693266 1:121299929-121299951 GTGGACTCTAAAACAGAGCAAGG + Intronic
914144289 1:144980151-144980173 GTGGACTCTAAAACAGAGCAAGG - Intronic
914203289 1:145505452-145505474 GTGGAAAAGAACACAGAGGAAGG + Intergenic
914237218 1:145823375-145823397 GTGGAAAAGAACACAGAGGAAGG + Intronic
914482411 1:148078606-148078628 GTGGAAAAGAACACAGAGGAAGG + Intergenic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
918892697 1:190295695-190295717 GTGGAATACAACACAGGGCAGGG - Intronic
919326867 1:196119158-196119180 GGGGACTCCAAAAGAGGGGAGGG + Intergenic
920480589 1:206318298-206318320 GTGGACTCTAAAACAGAGCAAGG + Intronic
921585544 1:216942069-216942091 GGGGACTCCAAAAGAGGGGAGGG - Intronic
921692977 1:218174112-218174134 GTTGACAACAAATGAGAGGATGG - Intergenic
923536761 1:234858436-234858458 GTCTACTACAAATAAGAGGAAGG - Intergenic
1064858691 10:19800539-19800561 GTTAACTACAAAAAAAAGGATGG - Intergenic
1064962116 10:20976758-20976780 GGGGACTTCAAAAGGGAGGAGGG + Intronic
1065169930 10:23016856-23016878 GTTACCTACAAAACAGAGGCAGG - Intronic
1065261617 10:23929466-23929488 GGGGACTCCAAAAGTGAGGAAGG - Intronic
1066688323 10:38002222-38002244 GTGGACTCCAAAAGGGGGGAGGG + Intergenic
1067005536 10:42657350-42657372 GTGGACTCCAAAAGGGGGGAGGG - Intergenic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1067493720 10:46741675-46741697 GGGGACTCCAAAACAGGGGAAGG - Intergenic
1067518838 10:46979248-46979270 GTGGTCTACAAATCAAAGCAGGG + Intronic
1067600940 10:47598730-47598752 GGGGACTCCAAAACAGGGGAAGG + Intergenic
1067643409 10:48072586-48072608 GTGGTCTACAAATCAAAGCAGGG - Intergenic
1068278623 10:54837795-54837817 GTGATATACAAAATAGAGGAGGG + Intronic
1069153342 10:64994014-64994036 GGAGACTACATAAGAGAGGATGG - Intergenic
1070341129 10:75499356-75499378 GTGGACTAGTGAAGAGAGGATGG + Intronic
1070473521 10:76809556-76809578 GTGAACTACAAAGCAGAGTATGG + Intergenic
1071012796 10:80957418-80957440 GCGGAATACAAAGCAGAGGCAGG - Intergenic
1071318933 10:84432408-84432430 GGGGACTACTAGACAGGGGAGGG - Intronic
1071652483 10:87406597-87406619 GGGGCCTCCAAAACAGGGGAAGG + Intergenic
1072287505 10:93929962-93929984 ATGGAAAACAAAACAAAGGAGGG + Intronic
1073654395 10:105397112-105397134 GATGACTGCAAACCAGAGGAGGG - Intergenic
1074407781 10:113193993-113194015 GTGAAAGAGAAAACAGAGGAGGG + Intergenic
1075349497 10:121710970-121710992 CTGGACTACAACACACAGGACGG + Intergenic
1077346676 11:2061587-2061609 GTGGAATCCAAAAGAGAGAATGG - Intergenic
1079127840 11:17731392-17731414 GTGGACTAAAAAAAAGGTGAAGG - Intergenic
1079143375 11:17829379-17829401 GTGGTCCACAAACCAGAGGCAGG - Intronic
1079994791 11:27284693-27284715 GTGGACTACCAAAGATAGGTGGG + Intergenic
1081059511 11:38455833-38455855 GTGGACTAAGATACAGAGGATGG + Intergenic
1081942577 11:46956239-46956261 GGGGAATACAAAAGAAAGGATGG + Intronic
1082828454 11:57598075-57598097 GGGGAAAACAAAACAGAGGGAGG + Intronic
1083383979 11:62293846-62293868 GTGGATTCCAAAACAGAGCCAGG + Intergenic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1086874834 11:92083106-92083128 GGGGGCAACAACACAGAGGAAGG + Intergenic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1087901468 11:103646268-103646290 GGGGACTGCAAAAGAGGGGAAGG + Intergenic
1089061654 11:115630722-115630744 CTGGAAAACAAAAGAGAGGAGGG - Intergenic
1091530341 12:1348837-1348859 GTGAATCATAAAACAGAGGAAGG - Intronic
1094114078 12:26891220-26891242 GTGGGTAACAAAACAGAGAAAGG - Intergenic
1094317710 12:29150228-29150250 GTATCCTACAAACCAGAGGAAGG + Intronic
1094577803 12:31703452-31703474 GGGGACTTCAAAAGGGAGGAAGG - Intronic
1095139382 12:38642901-38642923 GGGGACTACAAGAGAGAGAAAGG - Intergenic
1097478266 12:60086561-60086583 ATGTACTTGAAAACAGAGGAAGG + Intergenic
1097973094 12:65656082-65656104 TTAGAATACAAAACAGAGAAAGG - Intergenic
1098371361 12:69763761-69763783 GGGGACTACTAGACAGGGGAGGG - Intronic
1101168810 12:102066582-102066604 ATGGACTACATATTAGAGGATGG + Intergenic
1102637563 12:114337355-114337377 GTGGACTACTAGAGAGGGGAGGG - Intergenic
1104216769 12:126741519-126741541 GAGGCATACACAACAGAGGAAGG + Intergenic
1106177417 13:27343017-27343039 AGGGACTCCAAAAGAGAGGAGGG - Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1108774714 13:53751651-53751673 TTGAGCTAAAAAACAGAGGAAGG + Intergenic
1109484341 13:62998517-62998539 GTAGAATCCAAAAAAGAGGAAGG + Intergenic
1109815695 13:67581187-67581209 GGGGACTACAAGAAAGGGGAAGG - Intergenic
1110179375 13:72596925-72596947 GGGGACTCCAAAATGGAGGAGGG + Intergenic
1110520864 13:76474717-76474739 TTGGACTACAAAACAGCTGTGGG - Intergenic
1110551388 13:76814640-76814662 GGGGACTCCAAAATAGGGGAGGG - Intergenic
1112603895 13:100884575-100884597 GTTGACTGCAGAAGAGAGGATGG - Intergenic
1112851109 13:103707610-103707632 CTTGTCTACATAACAGAGGAAGG - Intergenic
1113593537 13:111516782-111516804 GGGGACTACTAGACAGGGGAGGG - Intergenic
1114867704 14:26617755-26617777 GGGGACTACAAGACAGCAGAGGG + Intergenic
1115641139 14:35336506-35336528 GGCGATTACAAAACAGAGGACGG - Intergenic
1116922557 14:50595227-50595249 GTGGGGGACAAAACAGAAGAAGG - Intronic
1116982552 14:51186878-51186900 GAGAACAAAAAAACAGAGGAAGG + Intergenic
1118922998 14:70167110-70167132 GTGGACTACAAAACAGAGGATGG - Exonic
1119049037 14:71347961-71347983 GTGGAATACAAAAGAGAAAAGGG + Intronic
1120367218 14:83586557-83586579 GGGGACTACAAAAGGGAGTAAGG + Intergenic
1120511784 14:85424278-85424300 GTGGATAATAAAATAGAGGAGGG - Intergenic
1120544356 14:85792389-85792411 GTGGACTACAAGAAGGGGGAGGG + Intergenic
1120710545 14:87788876-87788898 GTGGTCTACAAGTCAGAGCAGGG - Intergenic
1120748355 14:88174273-88174295 GGGGACTCCAAAACTGGGGAAGG + Intergenic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121927352 14:97940239-97940261 GTGGAAAACAAAACATAGGTAGG + Intronic
1124074218 15:26427565-26427587 GTGTACCAAAAAACAAAGGAAGG - Intergenic
1124422769 15:29537208-29537230 GGGGACTACCAAGCAGAGAAAGG + Intronic
1126438406 15:48660375-48660397 GGGGACTACTACAGAGAGGAGGG + Intergenic
1128790302 15:70428344-70428366 CTTGACTGCAGAACAGAGGACGG + Intergenic
1129139562 15:73584952-73584974 GTGGTCTACAAAAGAAAAGAAGG - Intronic
1134466992 16:14487753-14487775 GTTGACTACAAAGAAGGGGAGGG + Intronic
1134590530 16:15449358-15449380 GGGGACTACAAGAGGGAGGAAGG + Intronic
1135066662 16:19315835-19315857 GTGGACTACAAAAAAAGGGAAGG + Intronic
1135460398 16:22637344-22637366 GGGGAATACAAAATGGAGGAGGG - Intergenic
1136400856 16:30017626-30017648 GGGGACTCCAAAAAAGGGGAGGG + Intronic
1136690748 16:32026601-32026623 GTGGACTGCTAGACAGTGGAGGG - Intergenic
1136791336 16:32970170-32970192 GTGGACTGCTAGACAGTGGAGGG - Intergenic
1137272625 16:46912314-46912336 GAGGACTGCAACCCAGAGGAAGG - Intronic
1137441808 16:48504449-48504471 GTAGATTTCAAAACATAGGAGGG - Intergenic
1137779614 16:51086983-51087005 AAGGACTATAAAACACAGGAAGG - Intergenic
1138742624 16:59328499-59328521 GGGGACTGCTAAAGAGAGGAGGG - Intergenic
1139196777 16:64928725-64928747 GTGGACTACTACAGAGTGGACGG + Intergenic
1141774775 16:86115978-86116000 GTGGCCTGCAAAGCAGAGGGAGG - Intergenic
1203093544 16_KI270728v1_random:1231632-1231654 GTGGACTGCTAGACAGTGGAGGG - Intergenic
1142934302 17:3314845-3314867 GTGAACTACTAAAAAGAGGAGGG - Intergenic
1144766486 17:17735772-17735794 AGGGACCACAAAAGAGAGGAAGG - Intronic
1146201756 17:30864502-30864524 GGGGACTACAAAAGGGAGGAGGG - Intronic
1147054307 17:37822640-37822662 GAGGACTAGAGAAGAGAGGAAGG - Intergenic
1149352515 17:55805363-55805385 GGGGACTACAAAATGGGGGAAGG - Intronic
1150636451 17:66916549-66916571 ATGGACTACAAAGGGGAGGATGG + Intergenic
1151593172 17:75060185-75060207 GTTGCCTTCAAAACATAGGAAGG + Intronic
1152417177 17:80170220-80170242 GTGGACTAGAGAACAGAAAACGG + Intronic
1153326490 18:3826114-3826136 GAGGACTCCAAAAGAGGGGATGG + Intronic
1154068435 18:11130874-11130896 GTGGGGTACAGAACAGGGGAAGG + Intronic
1155581884 18:27318147-27318169 ATGGACTACAAATAAAAGGATGG - Intergenic
1157644122 18:49249647-49249669 GAAGACTACAAAACAGAAGTTGG - Intronic
1163030576 19:14541471-14541493 ATGGACTGGAAAACAGAGGCAGG - Intronic
1166120353 19:40682723-40682745 GTGGACGACAAAACCAAGGTAGG - Exonic
1167096179 19:47376115-47376137 TTGGAGGACAAAACATAGGATGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
925208571 2:2027318-2027340 GTGGGCTACAACACAGAGTAGGG - Intronic
925543327 2:4989980-4990002 GTGGACAGCAAAACAGTGCAAGG - Intergenic
926491679 2:13532470-13532492 GTGCACCACAAAACAAAGAATGG + Intergenic
927640273 2:24841439-24841461 GTGGCCAAGAAAGCAGAGGAAGG + Intronic
927695841 2:25239211-25239233 TTGGACTACAAAACAGGAGACGG + Exonic
929311285 2:40428935-40428957 GTTGACTTCAGAACAGAGGATGG - Exonic
929399920 2:41567659-41567681 ATGGACTTTAAAACAGAAGAAGG - Intergenic
930565246 2:53010697-53010719 GTGGACTACAAGAGGGTGGAAGG - Intergenic
931218053 2:60264402-60264424 ATGCACTACAGAACACAGGAAGG - Intergenic
931519828 2:63083593-63083615 GTGGACTCCAAAAGTGGGGAGGG - Intergenic
931663984 2:64596956-64596978 GTGGATGACAGAGCAGAGGAAGG - Intergenic
931810244 2:65847845-65847867 GGGGACTTCAAAACACAGGGAGG - Intergenic
932305302 2:70697719-70697741 GTGGTCTACAAAAGCGAGGGCGG + Intronic
935361889 2:102252066-102252088 GGGGACTTCAAAATGGAGGAGGG - Intergenic
937225292 2:120365357-120365379 GTGGTCTGCAACACAGAGGTTGG + Intergenic
937498767 2:122454465-122454487 GGGGACCACTAAACAGGGGAGGG + Intergenic
937651813 2:124327475-124327497 CTGAATTACAAAACTGAGGAGGG - Intronic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
940878733 2:158924323-158924345 GTGCACCCCAAAAGAGAGGAGGG + Intergenic
941823113 2:169862433-169862455 GTAAACTACAAAGCAGAGAAAGG - Intronic
941925172 2:170887194-170887216 GGGGACTCCAAAAGTGAGGAGGG + Intergenic
944850148 2:203710788-203710810 GTTGTCTAAAAATCAGAGGACGG + Intronic
945321667 2:208431594-208431616 TTGGAATAGAAAACAGTGGAGGG - Intronic
947038896 2:225892481-225892503 GAGGACTCCAAAATAGAAGAAGG + Intergenic
949049021 2:241887307-241887329 GAGGACGCCAAACCAGAGGACGG - Intergenic
1171514852 20:25721112-25721134 GGAGACTACAAAAGATAGGAGGG - Intergenic
1172590625 20:36115289-36115311 TTGGCCTACCAAACAGAGGCTGG - Intronic
1176981824 21:15390927-15390949 GGGGACTACTAGAGAGAGGAAGG - Intergenic
1177168627 21:17630885-17630907 ATGGATTACAGAAAAGAGGAAGG + Intergenic
1177542125 21:22507822-22507844 GAGGACTACTAGACAGTGGAGGG - Intergenic
1178032010 21:28538650-28538672 GTGGACCACTAGACAGGGGAGGG - Intergenic
1179026844 21:37686052-37686074 AGGGACTGCAGAACAGAGGATGG + Intronic
1180838124 22:18942062-18942084 GTGAACTAAAAAAAATAGGAGGG + Intergenic
950771115 3:15311968-15311990 CTGGACTACAAGACTGAAGATGG - Intronic
951919636 3:27840404-27840426 GTGGAACACAGAACAGAGTATGG + Intergenic
952812539 3:37417391-37417413 ATGGAATAATAAACAGAGGAAGG + Exonic
953015841 3:39075387-39075409 GCAGACAACAAAGCAGAGGAAGG + Intronic
953220018 3:40961015-40961037 GTGGACATCAAAACCCAGGAGGG - Intergenic
956956006 3:74340850-74340872 GGAAACTACAAAACAGAGGTAGG + Intronic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
959241768 3:103806074-103806096 GAGGATTACAAGACTGAGGAGGG - Intergenic
959746048 3:109777498-109777520 GTGGAGTCCAAAACAGAAGAAGG - Intergenic
960543821 3:118889436-118889458 GTGGAATACAGAGGAGAGGAAGG + Intergenic
961542548 3:127609811-127609833 GTTGACTGAGAAACAGAGGAAGG - Intronic
962049708 3:131800138-131800160 GAGAATTACAAAACAGAGGAGGG - Intronic
962115361 3:132500321-132500343 ACGGACTTCAAAATAGAGGATGG - Intronic
964419389 3:156485747-156485769 GGGGACTCCAAAAGAGGGGAGGG - Intronic
964810433 3:160657661-160657683 GGGGACTACTACACAGGGGAGGG - Intergenic
965083983 3:164070476-164070498 GTGGACTACCAAATGGTGGAGGG + Intergenic
965283255 3:166781942-166781964 GTGGAAAACAAAAAAGAGCAAGG - Intergenic
965362575 3:167759612-167759634 GGGGACTCCAAAACTGGGGAAGG + Intronic
967459312 3:189726753-189726775 GTGGAGTACAAAATAAAGGTGGG - Intronic
967470905 3:189861002-189861024 GAGGACTCCAAAAATGAGGAAGG - Intronic
967489124 3:190068966-190068988 GTGTACTACCAAACATGGGATGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
969541981 4:7797624-7797646 GCGGACTACAACACACAGGCTGG + Intronic
970365212 4:15351262-15351284 GAGGAGGAGAAAACAGAGGAAGG - Intronic
970397904 4:15689366-15689388 GTGGACTAGAGAACAGTTGAAGG + Exonic
971551293 4:27959900-27959922 GTGGACTACACAATAGAGAAAGG + Intergenic
971618330 4:28823183-28823205 GTGGAATACACAACAGATAAGGG + Intergenic
972153871 4:36131854-36131876 GTTTACTTAAAAACAGAGGAAGG - Intronic
972769484 4:42184004-42184026 GTGGACTCCTAAAAGGAGGATGG + Intergenic
973033947 4:45381877-45381899 GGAGACTACAAAATATAGGAGGG + Intergenic
973203146 4:47528249-47528271 GGGGACTCCAAAAGAAAGGAGGG - Intronic
974125162 4:57687341-57687363 GTGTGCTACAGAACATAGGATGG + Intergenic
974128066 4:57719789-57719811 GTGGAAAACAAAACAGACAAAGG + Intergenic
977040512 4:92011449-92011471 GTGGACTACTAGAGAGTGGAGGG - Intergenic
977575999 4:98674669-98674691 GTGGCTTACAAAGGAGAGGAGGG - Intergenic
978628435 4:110714679-110714701 GTGGACTACTAAAGTGAGGAGGG + Intergenic
978633823 4:110779973-110779995 GTGGACTCCAAGAGAAAGGAAGG - Intergenic
979182308 4:117745737-117745759 GGGGACTACTACACACAGGAGGG + Intergenic
979583973 4:122392544-122392566 GTGGACTACTAAAGGGTGGAGGG + Intronic
979689865 4:123548471-123548493 GTTGAGGACAGAACAGAGGAAGG - Intergenic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
980555624 4:134400105-134400127 GTGGACTACTAGAGAGTGGAGGG - Intergenic
982626891 4:157778876-157778898 TAGGACTCCAGAACAGAGGAAGG + Intergenic
983018662 4:162647133-162647155 GGGGACTCCAAAAAAGGGGAGGG - Intergenic
983040508 4:162919777-162919799 GGGGACTACAAAAGAAGGGAAGG + Intergenic
983956332 4:173702879-173702901 GAGGACTCCAAAAAAGAAGAGGG + Intergenic
984398193 4:179227096-179227118 GTGCATTTTAAAACAGAGGAAGG - Intergenic
985198251 4:187456385-187456407 GGGGATTACAAAACAAAGCAAGG + Intergenic
985300942 4:188488692-188488714 GTGGACTACTAGACGGTGGAGGG - Intergenic
985994268 5:3588029-3588051 ATGTCCTACAAAAGAGAGGATGG + Intergenic
990659921 5:58001938-58001960 GTGAATTTCAAAAAAGAGGAGGG - Intergenic
990667969 5:58094957-58094979 GTAGACTATAAAAGAGAGGGAGG - Intergenic
991212492 5:64122027-64122049 GGGGATTCCAAAACAGGGGAGGG - Intergenic
992194212 5:74323985-74324007 GTGGACTGCAGTACAGAGGAAGG - Intergenic
992542656 5:77779911-77779933 TTGAATTACAAAAGAGAGGAGGG - Intronic
993836195 5:92823070-92823092 GGGGAATACAAAAGACAGGAGGG + Intergenic
994445933 5:99874004-99874026 GGGGACTCCAAAAGAAAGGAGGG + Intergenic
994798948 5:104345127-104345149 ATGGAAAACAAAACAGAGGATGG + Intergenic
996165768 5:120220890-120220912 GGGGACTTCAAAAATGAGGATGG - Intergenic
996342415 5:122453585-122453607 ATGGACTACATAACACAGAAAGG + Intronic
997076984 5:130690582-130690604 GTGGAGCACAAAACAGTGTATGG - Intergenic
997455597 5:134015198-134015220 GTGGACTACAAGAGAGGGGAGGG + Intergenic
997649825 5:135508141-135508163 GGGGACTGCAAAAGAGGGGAAGG + Intergenic
997774834 5:136593399-136593421 GTGGAAAACAAAAAAGAGCAGGG + Intergenic
998175679 5:139900653-139900675 GTGGGCTGGAGAACAGAGGAGGG + Intronic
999134961 5:149312410-149312432 GTGCAGTACAAGCCAGAGGAGGG + Intronic
999178040 5:149645816-149645838 GGGGACTAATAAACAGAGGTCGG - Intergenic
999398640 5:151247692-151247714 GTATACTAGAAAACTGAGGAAGG - Intronic
1000322276 5:160143978-160144000 GGGGACTCCAAAAGAGCGGAGGG - Intergenic
1003009697 6:2414983-2415005 GTTGCCCAGAAAACAGAGGATGG - Intergenic
1003295499 6:4822813-4822835 CTGAACAACAAAACACAGGACGG - Intronic
1003631451 6:7791305-7791327 GTGGACGCAAACACAGAGGAGGG - Intronic
1003745404 6:8995961-8995983 GGGGACTCCAAAAGGGAGGAGGG - Intergenic
1008608698 6:53166204-53166226 GAGGACTCCAAAAGAGGGGAGGG + Intergenic
1009803073 6:68567344-68567366 GAGGACTCCAAAAGGGAGGAGGG - Intergenic
1009854564 6:69245238-69245260 GTGGGCTACAGAATAGAGAATGG - Intronic
1010348935 6:74848378-74848400 GGGGACCCCAAAACAGGGGAAGG + Intergenic
1011938861 6:92817511-92817533 GTGGATTACAAAACACACTATGG - Intergenic
1012229071 6:96739151-96739173 GTGTATTAAAAAACAGAGCAAGG + Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1013933502 6:115565139-115565161 GAGGACTTGAAAAGAGAGGAGGG + Intergenic
1014527079 6:122513631-122513653 GTGAACTACTAGACAGGGGAGGG - Intronic
1015058086 6:128928922-128928944 GTGGAATACACAACAGATAAGGG + Intronic
1016381380 6:143485444-143485466 TTGGACTACAACACGGAGAAAGG - Intronic
1016388696 6:143553790-143553812 GGTGATTACAAAGCAGAGGAAGG + Intronic
1016528603 6:145033317-145033339 GTGGAATAAGAAACAAAGGATGG - Intergenic
1016617306 6:146066223-146066245 GGGGAATACAAGAGAGAGGAAGG - Intronic
1017163176 6:151384428-151384450 GTGGTCTACAAAAGAGATGATGG + Intronic
1017743981 6:157430507-157430529 TTGGCTTTCAAAACAGAGGAAGG - Intronic
1018752370 6:166818599-166818621 ATGGACGACAAAACTGGGGAAGG - Intronic
1018784271 6:167095950-167095972 GTGGACCACATCCCAGAGGATGG - Intergenic
1020807003 7:12802362-12802384 GTGTGCTGGAAAACAGAGGAAGG + Intergenic
1021383682 7:20001576-20001598 GTGGACTACTAAAATGGGGAGGG + Intergenic
1023939796 7:44762080-44762102 GTGGACAGCAAAACAGCAGACGG - Intronic
1024815295 7:53261790-53261812 GGGGACTCCAAAATAGGGGAGGG + Intergenic
1025101407 7:56138361-56138383 GGGGACTCCAAAAGAGGGGAGGG + Intergenic
1026083863 7:67246304-67246326 GGGGTCTACAAAACTGGGGAGGG + Intergenic
1026693175 7:72567747-72567769 GGGGACTACAAAACTGGGGAGGG - Intronic
1026994072 7:74604604-74604626 AGGGAGTACAAAACAGAGTAGGG + Intergenic
1027139289 7:75645928-75645950 GGGGACTCCAAAAGGGAGGAGGG + Intronic
1027444939 7:78262981-78263003 GGGGACTACTAGACAGAGGAGGG - Intronic
1029950531 7:104579314-104579336 GGGGATTCCAAAAGAGAGGAGGG - Intronic
1031731312 7:125304394-125304416 GTGGACTACTAGAAAGTGGAGGG + Intergenic
1039679955 8:39722512-39722534 GGGGACTCCAAAACATTGGAAGG + Intronic
1040017537 8:42711861-42711883 GGGGACTCCAAAAGAGATGAAGG - Intronic
1040410397 8:47148484-47148506 GGGGACTACCAGACAGAGAACGG + Intergenic
1041114148 8:54517974-54517996 GTGGACAACAGATAAGAGGATGG - Intergenic
1041584931 8:59505371-59505393 GGGGACTCCAAAAGGGAGGAAGG + Intergenic
1042391599 8:68241989-68242011 GTGGACTTTAAATCAGAGTATGG - Intergenic
1043824424 8:84908407-84908429 GTGGAATCTAAAACAGAGGTAGG - Intronic
1043835909 8:85045675-85045697 GTGGACTACCAGAGAGGGGAGGG - Intergenic
1043871145 8:85434420-85434442 GGGGACTCCAAAAGAGGGGAGGG + Intronic
1044068189 8:87723589-87723611 GGGGACTACTAAAGCGAGGAGGG - Intergenic
1046421338 8:113987148-113987170 GTGGACTACTAGAGAGGGGAAGG + Intergenic
1046526700 8:115389963-115389985 GAGGAGCACAAATCAGAGGAGGG - Intergenic
1047827250 8:128590573-128590595 GGGGACTCCAAAAGAGAGAAGGG + Intergenic
1048041989 8:130739534-130739556 GGGGACTACAAGAGAGGGGAGGG + Intergenic
1048724460 8:137366713-137366735 GGGGACTCCAAAAGAGGGGAGGG - Intergenic
1049053381 8:140216543-140216565 GTGGAACACAAAGCAAAGGAAGG + Intronic
1051043892 9:12850228-12850250 GTGGACTTGAAAGCAGAGAAAGG - Intergenic
1051311865 9:15783596-15783618 GTGAAGTATAAAAAAGAGGAAGG - Intronic
1051792477 9:20822419-20822441 GTGGATTAGAAAGGAGAGGAAGG + Intronic
1052660849 9:31429025-31429047 GTGGTGTACAAAACATAGGAGGG + Intergenic
1053088668 9:35252026-35252048 GAAGTCTACAAAACAGATGAGGG - Intronic
1056466264 9:86858568-86858590 GTGGACCACAAATCAGAAGATGG + Intergenic
1056751002 9:89351116-89351138 GTGGCCTGCACAACAGAGGCAGG - Intronic
1057991602 9:99776352-99776374 AAGGACTACAGAGCAGAGGAGGG + Intergenic
1060013720 9:120067655-120067677 TTCAACTACAAAACAGAGGAGGG + Intergenic
1185931099 X:4204322-4204344 GGGGACTCCAAAAAAGGGGAGGG + Intergenic
1186352664 X:8756307-8756329 CAGGACTACAGAACAGAAGACGG + Intergenic
1186634661 X:11389739-11389761 ATGGAAAACAAAACAGAGGTGGG + Intronic
1186944737 X:14553214-14553236 GTGGCCTTCAAATCAGAGAAAGG + Intronic
1187671519 X:21670855-21670877 GGGGACTCCAAAAGAGGGGAGGG - Intergenic
1188065325 X:25652119-25652141 GGGGACTACTAGACAGGGGAGGG - Intergenic
1188575427 X:31644122-31644144 TTGGAATACAAAAAAGAAGATGG + Intronic
1189701018 X:43716347-43716369 ATGAACTACAAAATTGAGGAAGG + Intronic
1189960804 X:46323291-46323313 GTGGATTATAAAACCTAGGAAGG - Intergenic
1190428159 X:50352018-50352040 GAAGACTTCTAAACAGAGGAGGG - Intergenic
1193904453 X:87225604-87225626 GTGGAGTCCAGAACAGAAGAAGG + Intergenic
1194067484 X:89279511-89279533 ATGGAAAACAAAACAGAGCAAGG + Intergenic
1195298674 X:103505488-103505510 ATGGACTAAAAAAAAGAGTAAGG - Intronic
1195470483 X:105224110-105224132 CAGGACAAAAAAACAGAGGAAGG + Intronic
1195806990 X:108784950-108784972 GTTGACTACTAGACGGAGGAGGG - Intergenic
1195930743 X:110072995-110073017 GGGGACTACAAGAGAGGGGAGGG - Intronic
1195987804 X:110649835-110649857 GGGGACTCCAAAACAGGGTAGGG - Intergenic
1197007874 X:121524863-121524885 ATGGAAAAAAAAACAGAGGATGG + Intergenic
1197027361 X:121769873-121769895 GTACACTACAAAACAAAAGAAGG - Intergenic
1197412353 X:126134524-126134546 GGGGACTCCAAAAGAAAGGAGGG - Intergenic
1197412480 X:126136512-126136534 GTGGAAAACAAAAAAGAGCAGGG - Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1199426378 X:147705666-147705688 GGGGACTACTAGATAGAGGAGGG + Intergenic
1200721638 Y:6613719-6613741 GTGGAAAACAAAACAGAGCAAGG + Intergenic