ID: 1118923131

View in Genome Browser
Species Human (GRCh38)
Location 14:70168039-70168061
Sequence GACCCGAATAGTGGTTGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118923126_1118923131 17 Left 1118923126 14:70167999-70168021 CCAGGGCCATAAGGGTCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG 0: 1
1: 0
2: 1
3: 1
4: 30
1118923128_1118923131 11 Left 1118923128 14:70168005-70168027 CCATAAGGGTCAGGTTGGAGACA 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG 0: 1
1: 0
2: 1
3: 1
4: 30
1118923125_1118923131 18 Left 1118923125 14:70167998-70168020 CCCAGGGCCATAAGGGTCAGGTT 0: 1
1: 0
2: 1
3: 14
4: 103
Right 1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG 0: 1
1: 0
2: 1
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118923131 Original CRISPR GACCCGAATAGTGGTTGTGC TGG Exonic
904904675 1:33886268-33886290 GACCAGAATAGAGGATGGGCAGG + Intronic
1064735252 10:18375622-18375644 GACCCTTATTGGGGTTGTGCAGG + Intronic
1070938332 10:80319948-80319970 TGCATGAATAGTGGTTGTGCAGG + Intergenic
1078146000 11:8722229-8722251 GACTCGAATGGGGGTTGTGGAGG - Intronic
1080914247 11:36639209-36639231 GACCAGAAAAGAGGTTGGGCTGG - Intronic
1085487313 11:76876251-76876273 AATCAGAACAGTGGTTGTGCTGG - Intronic
1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG + Exonic
1121391639 14:93581129-93581151 GACACAAATACTGGTTGTCCAGG - Intronic
1161601308 19:5185241-5185263 GAACAGATTAGTGGTTGTGATGG - Intronic
938988955 2:136608332-136608354 GACCCGAATAGTGGTTCTGGGGG + Intergenic
1173447034 20:43128495-43128517 GGCCCCCATAGTGGTTGTGCTGG - Intronic
1183751316 22:39722461-39722483 GACCCGCACTGTGGCTGTGCGGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
963725071 3:148910667-148910689 AACCTGATTAGTGGTTGTGTAGG - Intergenic
965209535 3:165767584-165767606 GACCTGAATAGTTCTTGTGGAGG - Intergenic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
969919519 4:10524473-10524495 GAACAGAATAGTGGTTAAGCAGG - Intronic
977862007 4:101972952-101972974 GAGTAGAATAGTGGTTATGCAGG + Intronic
980323021 4:131303358-131303380 GACCCCAGTAGTGGTAGTGGTGG - Intergenic
983787750 4:171755277-171755299 GAACAGAATGGTGGTTGTGAGGG + Intergenic
988813080 5:34804518-34804540 GTCCCAAATAGTGCTTGTGAAGG - Intronic
991965512 5:72086477-72086499 GCCACAACTAGTGGTTGTGCCGG - Intergenic
1001904252 5:175458147-175458169 AAACAGAATAGTGGTTGTGGGGG + Intergenic
1019892479 7:3957145-3957167 GAACGGATTAGTGGTTGTGAGGG + Intronic
1022692756 7:32673431-32673453 GATTGGAACAGTGGTTGTGCTGG - Intergenic
1024122711 7:46261042-46261064 GACCAGTATAGTGGGGGTGCTGG + Intergenic
1032066253 7:128773813-128773835 GAGCCGCATGGTGGTTGTGATGG - Exonic
1039785662 8:40832365-40832387 GTGCAGAATTGTGGTTGTGCAGG - Intronic
1049752127 8:144289999-144290021 GACCCGAACACTGTGTGTGCCGG - Intronic
1056940134 9:90948326-90948348 GACCTGAGTACTGGTTATGCAGG + Intergenic
1193582087 X:83278281-83278303 CACCCCACTAGTGGTTGTTCTGG - Intergenic
1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG + Intergenic
1197989430 X:132301648-132301670 GAACAGAATAATGGTTGTGAGGG - Intergenic