ID: 1118931653

View in Genome Browser
Species Human (GRCh38)
Location 14:70247508-70247530
Sequence TCCCCTTGAAGGTGATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931653_1118931655 -9 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931653_1118931661 10 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349
1118931653_1118931659 7 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931653_1118931658 6 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931653_1118931662 11 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640
1118931653_1118931656 -8 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931653 Original CRISPR TCCCCTTGAAGGTGATCAGC AGG (reversed) Intergenic
No off target data available for this crispr