ID: 1118931655

View in Genome Browser
Species Human (GRCh38)
Location 14:70247522-70247544
Sequence TCAAGGGGATCACCACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931653_1118931655 -9 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931645_1118931655 18 Left 1118931645 14:70247481-70247503 CCATCCAGGAGCCTTTGCACTTC No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931651_1118931655 -8 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931649_1118931655 -7 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931647_1118931655 7 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data
1118931646_1118931655 14 Left 1118931646 14:70247485-70247507 CCAGGAGCCTTTGCACTTCTGCC No data
Right 1118931655 14:70247522-70247544 TCAAGGGGATCACCACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931655 Original CRISPR TCAAGGGGATCACCACTTCC AGG Intergenic
No off target data available for this crispr