ID: 1118931656

View in Genome Browser
Species Human (GRCh38)
Location 14:70247523-70247545
Sequence CAAGGGGATCACCACTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931647_1118931656 8 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121
1118931653_1118931656 -8 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121
1118931645_1118931656 19 Left 1118931645 14:70247481-70247503 CCATCCAGGAGCCTTTGCACTTC No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121
1118931646_1118931656 15 Left 1118931646 14:70247485-70247507 CCAGGAGCCTTTGCACTTCTGCC No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121
1118931649_1118931656 -6 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121
1118931651_1118931656 -7 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG 0: 1
1: 1
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931656 Original CRISPR CAAGGGGATCACCACTTCCA GGG Intergenic
900940463 1:5795360-5795382 AAAGGGGAGCCCCACTTCCAAGG + Intergenic
901481701 1:9529664-9529686 CTAGGGGATGGCCACATCCATGG + Intergenic
902474279 1:16672984-16673006 CAAGGGGGTGCCTACTTCCATGG + Exonic
902484524 1:16734458-16734480 CAAGGGGGTGCCTACTTCCATGG - Exonic
903989455 1:27255913-27255935 CTGGGGGAAAACCACTTCCAGGG - Intronic
906126629 1:43431045-43431067 CGTGGGGAGCTCCACTTCCAGGG - Exonic
906892484 1:49732073-49732095 AAAAGTGATGACCACTTCCAGGG + Intronic
908411346 1:63868741-63868763 CAAGGGGATCAGGAGTTTCATGG + Intronic
910168614 1:84354273-84354295 CTTGGGGTTCACCACCTCCAAGG - Intronic
912945742 1:114082629-114082651 CAGGGGGATGACAACTTTCATGG - Intergenic
912954829 1:114148019-114148041 GAAGGGGATCTCAACTTCCCAGG - Intronic
916626211 1:166558051-166558073 TATGGGGATCACTACTTTCAAGG + Intergenic
918051609 1:180977906-180977928 CAAGGTGATCACCACTTAGAAGG - Intronic
920507798 1:206528976-206528998 CAGGGGATTCACCACTTCCTTGG - Intronic
1063303124 10:4871572-4871594 CATTGTGATCACCCCTTCCAGGG + Intergenic
1063962446 10:11318326-11318348 CCAGGGGCTCGCCACCTCCATGG - Intronic
1064240930 10:13627820-13627842 CATGGGGAAAACCACCTCCAAGG + Intronic
1067931808 10:50569512-50569534 CCAGTGGAGCACCATTTCCATGG - Intronic
1068381222 10:56255675-56255697 CAAGGGGACCTCCTCTTCCGTGG + Intergenic
1070558670 10:77549456-77549478 TAGGAGGATCACCTCTTCCAAGG - Intronic
1079103054 11:17553271-17553293 GAAAGGGAGCAGCACTTCCAGGG + Intronic
1082773796 11:57230457-57230479 CAAGGAGTTCAACACTTGCAGGG - Intergenic
1083548536 11:63567122-63567144 CAAGGAGATGACCACGTCCTTGG + Intergenic
1083657342 11:64235855-64235877 CAAGGGCACCACCACCTCCCGGG - Exonic
1086742078 11:90380348-90380370 CAAGGGGATCTCCTTATCCATGG + Intergenic
1087606399 11:100383651-100383673 CAAAGGGATCTCCTGTTCCAAGG - Intergenic
1088142478 11:106634011-106634033 AGAGGGGAAAACCACTTCCAGGG + Intergenic
1091897786 12:4119014-4119036 CAGGGGGCTCACCACCTCCAGGG + Intergenic
1093405874 12:18803239-18803261 TAAGTGGATCACCACTTTCCAGG - Intergenic
1096004304 12:48156864-48156886 CAAGGGGATCAAACCTTACACGG - Intronic
1096248095 12:50007329-50007351 CAAAGAGAACATCACTTCCAAGG + Intronic
1098966643 12:76797460-76797482 CAAGAGGTTCACCATATCCATGG - Exonic
1100870365 12:98904386-98904408 CGAAGGGGTCACTACTTCCAAGG + Intronic
1101295847 12:103423138-103423160 CAAGGGCATCAATGCTTCCAGGG - Intronic
1106568228 13:30905544-30905566 CAAGGAGATCACCACCTACTGGG + Intergenic
1108316355 13:49241208-49241230 TCAGGGGAGCACCATTTCCAGGG + Intergenic
1108629672 13:52269261-52269283 CAAGGGGATCCCCTGATCCATGG + Intergenic
1108656386 13:52537227-52537249 CAAGGGGATCCCCTGATCCATGG - Intergenic
1112308957 13:98300957-98300979 CAACAGGATCACCAATTCCAGGG - Intronic
1113798948 13:113076740-113076762 CAAGGGCATCACCAGGTCCCAGG - Intronic
1115154873 14:30327171-30327193 CCAGGGAAACATCACTTCCATGG - Intergenic
1118690984 14:68339437-68339459 CAGGGGATTCACCACTTCCTTGG + Intronic
1118931656 14:70247523-70247545 CAAGGGGATCACCACTTCCAGGG + Intergenic
1118953507 14:70457615-70457637 CAAGGGGATCACCACTTCCGGGG - Exonic
1122940990 14:104981298-104981320 CACGGGGCTGCCCACTTCCAAGG + Intergenic
1123840571 15:24243358-24243380 CAAGGGAATTACCATTTACAAGG - Intergenic
1123869489 15:24556478-24556500 CAAGGGAATTACCATTTACAAGG - Intergenic
1124923250 15:34046930-34046952 CAAGGAGATCTCCTTTTCCATGG - Intronic
1126956158 15:53935808-53935830 CAAGGGGGTCTCCTGTTCCATGG - Intergenic
1129096123 15:73210260-73210282 AAAGGGTATCACCACTTCAAGGG - Intronic
1129300688 15:74623878-74623900 CAGGGAGCTCATCACTTCCAAGG - Intronic
1129347641 15:74933915-74933937 CAAGGAGATCACCACCTTCAAGG + Intronic
1132070816 15:98775383-98775405 CAACTGAATCACCATTTCCAGGG + Intronic
1137387764 16:48056962-48056984 AAAGGGCATCAACACTTTCAGGG - Intergenic
1138295326 16:55880398-55880420 CAATGGGAGCCCCACTTCCTAGG - Intronic
1139914657 16:70420584-70420606 CCAGGAGATAACCACCTCCAAGG - Intronic
1141501588 16:84448564-84448586 GTAGCGGATCACCTCTTCCAAGG - Exonic
1142474037 17:179616-179638 CCAGGGGATCACCAAGTCCAGGG + Intronic
1143058003 17:4176845-4176867 CAAGTGGATCTCCACTTCCTCGG + Intronic
1143296668 17:5876402-5876424 CCAGGGGCTCCCCACTTGCAAGG + Intronic
1143813041 17:9488003-9488025 CAAGTGAATCACAACCTCCAGGG - Intronic
1147231726 17:39024254-39024276 CAATAGCATGACCACTTCCAAGG - Intergenic
1148174870 17:45555000-45555022 CAACAGCATGACCACTTCCAAGG + Intergenic
1148296501 17:46508027-46508049 CAACAGCATGACCACTTCCAAGG - Intergenic
1150406087 17:64901911-64901933 CAACAGCATGACCACTTCCAAGG + Intronic
1150785093 17:68155886-68155908 CAATAGCATGACCACTTCCAAGG + Intergenic
1152786898 17:82253004-82253026 CCAGGGGCTCACCAATTCCAAGG + Exonic
1156746120 18:40393419-40393441 GAAGCTAATCACCACTTCCAGGG + Intergenic
1158074067 18:53508283-53508305 CGAGAGGATAACCACTGCCAGGG - Intronic
1162032846 19:7924920-7924942 CAAGGGGGTCCCCACTTCCAGGG + Exonic
1162660936 19:12168619-12168641 CCAGGGGACCCCCACTTCCCTGG + Intronic
1165558324 19:36655905-36655927 CAAGGGTGCCAACACTTCCATGG - Intronic
1168644576 19:58051922-58051944 AGCGGGGATCACCACTTCCTGGG - Intronic
1202707656 1_KI270713v1_random:35388-35410 CAAGGGGGTGCCTACTTCCATGG + Intergenic
927024539 2:19052061-19052083 CAAAGAGATCAAGACTTCCAAGG + Intergenic
928883528 2:36123165-36123187 CAAGGGGATCTCCTGATCCATGG + Intergenic
932442810 2:71748505-71748527 CAAGGGAATCGCCATTCCCAGGG + Intergenic
933344037 2:81060774-81060796 CAAGTGTATAAACACTTCCATGG - Intergenic
933489901 2:82972510-82972532 GAAAGCTATCACCACTTCCATGG + Intergenic
936045988 2:109188355-109188377 CACAGTGATCACCACCTCCAGGG + Intronic
938303333 2:130231186-130231208 CAGGGGGGTCCCCTCTTCCAGGG - Intergenic
938453338 2:131443046-131443068 CAGGGGGGTCCCCTCTTCCAGGG + Intergenic
943551214 2:189341605-189341627 AAAGAGTATCATCACTTCCAGGG + Intergenic
946961106 2:224986891-224986913 CAAGGGAATCATCACCTCCTCGG + Intronic
1171142717 20:22757027-22757049 CACTGGTATCTCCACTTCCAGGG - Intergenic
1172586369 20:36088052-36088074 CAAGGAGTTCATCACTCCCAAGG + Intergenic
1176130617 20:63495241-63495263 CATGGGGGTCCCCACTTCAAGGG + Intronic
1181364860 22:22368184-22368206 AAACGGGCTCACCACTTCCTTGG - Intergenic
1181786039 22:25227975-25227997 CAGGGGGCTCACCACTTTGATGG - Exonic
1181818222 22:25455830-25455852 CAGGGGGCTCACCACTTTGATGG - Intergenic
1181969610 22:26680316-26680338 CAAGGTGGTCACCACACCCATGG + Intergenic
1184749096 22:46473964-46473986 CAAGGGGACAAGCACTTTCAGGG + Intronic
951714776 3:25628648-25628670 GAATGGGATCACCATTTCAATGG - Intronic
953473749 3:43188796-43188818 AGAGTGAATCACCACTTCCAAGG + Intergenic
960043059 3:113169948-113169970 CAATAGGCTCACCTCTTCCAAGG + Intergenic
963564217 3:146907376-146907398 TAAGGGAATCACCACTTCTAAGG + Intergenic
963855144 3:150245498-150245520 CTAGTGGATCACCACTTTCTTGG - Intergenic
965907314 3:173725001-173725023 GAAGGGGAACATCACATCCAGGG + Intronic
966958832 3:184912615-184912637 CATGGTGATCACCACCTGCATGG - Intronic
969952754 4:10854601-10854623 CAAGGGGATCTCCTGATCCACGG + Intergenic
979778348 4:124618230-124618252 CATGGGGGTAACCACTGCCATGG - Intergenic
990020443 5:51119738-51119760 CAAGAGGATCAACACTAGCAAGG + Intergenic
993018355 5:82562769-82562791 CAAGGGGATCTCCTGATCCATGG - Intergenic
994551400 5:101239372-101239394 CAAGGGGATCTCCTGATCCATGG + Intergenic
1003111119 6:3252970-3252992 CAAGGGGATCTGCCCTTCCCAGG + Intronic
1007536691 6:42597501-42597523 TAAGGGGATCACCAAAGCCAGGG + Intronic
1008122321 6:47632742-47632764 CAAGATTATCACCAGTTCCATGG + Intergenic
1008298350 6:49805134-49805156 CAAGGGGATCTCTTCATCCACGG - Intergenic
1010651260 6:78457862-78457884 TAAGGGGATGACGATTTCCAGGG + Intergenic
1012016737 6:93862455-93862477 CAAGGGTATTACCACATCAATGG - Intergenic
1013908468 6:115246061-115246083 CAAGGGAATCACCCATTTCAAGG + Intergenic
1016702574 6:147070007-147070029 CAAGGGCACCACCAATCCCAAGG - Intergenic
1016790831 6:148065202-148065224 CAAGGGGATCTCCTGATCCATGG + Intergenic
1016837298 6:148491160-148491182 CAAGGGGGTCACTATTTCCAAGG - Intronic
1019512154 7:1423064-1423086 CCAGGGGCCCCCCACTTCCAGGG + Intergenic
1024354969 7:48405150-48405172 CAAGGGGTCCCCTACTTCCATGG - Intronic
1025259761 7:57410987-57411009 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1025606211 7:63041660-63041682 CAGGGAGATCACTACTGCCAGGG + Intergenic
1027002453 7:74662949-74662971 TCAGGGGATCCCAACTTCCATGG + Intronic
1030223435 7:107122870-107122892 CATGGGGATTCCCACTACCAGGG + Intronic
1035619083 8:1024227-1024249 CACGGGGCTGTCCACTTCCAGGG - Intergenic
1040395395 8:46994092-46994114 CAATGGGTTCACAACTGCCAGGG + Intergenic
1043324519 8:79033812-79033834 CAAGGGTATCTCCAGATCCATGG - Intergenic
1043381565 8:79707867-79707889 AAGGGAGATCACGACTTCCAAGG - Intergenic
1048630155 8:136233800-136233822 CAAGGGAATCTCCAGATCCATGG + Intergenic
1054978759 9:71179386-71179408 CAAGGTGTACACCACTTCCAAGG + Intronic
1060340058 9:122767581-122767603 CAAGGGGATCTCCTGATCCATGG - Intergenic
1060707842 9:125822368-125822390 CAAGAGGAAAACCACTGCCATGG - Intronic
1060750674 9:126166404-126166426 CAAGGGAGTCACCACCTCCCAGG - Intergenic
1190641657 X:52486060-52486082 CAAGGTGAACCTCACTTCCAAGG + Intergenic
1190644189 X:52509737-52509759 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1190646015 X:52526805-52526827 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1191146081 X:57166430-57166452 CATGGGGATCGCCAATCCCATGG - Intergenic
1191768907 X:64733509-64733531 CAAGGGGATCTCCTGATCCATGG + Intergenic
1194953593 X:100154064-100154086 CAAGGGGATCTCCTGGTCCAAGG + Intergenic
1199680824 X:150223501-150223523 GAAAGGGACCACCACATCCATGG + Intergenic