ID: 1118931658

View in Genome Browser
Species Human (GRCh38)
Location 14:70247537-70247559
Sequence CTTCCAGGGAAGTGAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931653_1118931658 6 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931647_1118931658 22 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931649_1118931658 8 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931651_1118931658 7 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931654_1118931658 -5 Left 1118931654 14:70247519-70247541 CCTTCAAGGGGATCACCACTTCC No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224
1118931646_1118931658 29 Left 1118931646 14:70247485-70247507 CCAGGAGCCTTTGCACTTCTGCC No data
Right 1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG 0: 1
1: 1
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931658 Original CRISPR CTTCCAGGGAAGTGAAATGC TGG Intergenic
900921046 1:5670846-5670868 ATTCCAGGGAAGCTAAATCCTGG + Intergenic
903888477 1:26554877-26554899 CTTCCAAGGAAGAAAACTGCAGG - Intronic
904209507 1:28877428-28877450 CTTCCAGGGATGAGCAATGGAGG - Intergenic
905343392 1:37294711-37294733 CTTGCATGGTATTGAAATGCAGG + Intergenic
906331496 1:44888844-44888866 CTTCCAGGGAACAGGAATTCTGG + Intronic
908762360 1:67523919-67523941 TCACCAGGGATGTGAAATGCAGG + Intergenic
910549870 1:88463331-88463353 CTTCGAGGGAAGGGAATTGGTGG - Intergenic
911638817 1:100266082-100266104 CTGCCGGGGAAGTGAGATGACGG - Intergenic
912320264 1:108706424-108706446 ATTCCAGGGAAGAGAAACTCAGG - Intergenic
912615745 1:111097995-111098017 CTTACTGGGAACTGAAATGAAGG - Intergenic
916035882 1:160922154-160922176 CTGCTAGGGAAGGGAAATGTGGG + Intergenic
922501713 1:226101888-226101910 CTTCCAGGGCAATAACATGCAGG - Intergenic
923058027 1:230443071-230443093 CTTCCAGAGGAGAGAAACGCTGG + Intergenic
924013526 1:239693783-239693805 ATGCCATGCAAGTGAAATGCAGG + Intronic
924638362 1:245809947-245809969 CCTCCAGGTAGCTGAAATGCAGG + Intronic
924645644 1:245875030-245875052 CAGCCATGGAAGTGAAGTGCTGG + Intronic
924648458 1:245902083-245902105 ATTCCAGGGATGTGGAATGGAGG - Intronic
1063220451 10:3962110-3962132 CTTCCAGGAAGGTGAGCTGCTGG - Intergenic
1064263976 10:13809627-13809649 CCTGCAGGGAACTGGAATGCAGG - Intronic
1064310935 10:14211107-14211129 ATACCAGGGAAGTGAGATGGGGG - Intronic
1066976989 10:42378208-42378230 CTTCCAGGGAACAGGAATTCAGG - Intergenic
1067529400 10:47059578-47059600 CTAGCTGAGAAGTGAAATGCAGG + Intergenic
1067725364 10:48766671-48766693 CTTCCATGGATGTGGAATGGTGG + Intronic
1067894069 10:50160934-50160956 CTTCCACATAAGTGAAGTGCTGG - Intergenic
1067954778 10:50779330-50779352 CTTCCACATAAGTGAAGTGCTGG + Intronic
1070349081 10:75575025-75575047 CTTCCAGCCATGTGAAGTGCTGG - Intronic
1071210542 10:83337037-83337059 CTGACAGGGAAGAGCAATGCAGG + Intergenic
1072289296 10:93947885-93947907 CATCCACTGAAGTGAACTGCAGG + Intronic
1072640022 10:97204941-97204963 GTCCCAGGGAAGCGCAATGCTGG + Intronic
1073282322 10:102363564-102363586 CTTCCAGGGAAGTGGAAGACTGG + Intronic
1075715357 10:124552146-124552168 CTTCCAGGGTGGGGAAAGGCTGG - Intronic
1077081606 11:726881-726903 CTTCTAGGGAGGAGAAATGGGGG - Exonic
1080872146 11:36245802-36245824 CTTCCTGGAAAGTGAATTCCAGG - Intergenic
1082930291 11:58596008-58596030 GTTTCTGGGAAGTTAAATGCAGG - Intronic
1084185299 11:67468148-67468170 CCTCCCGGGAAGAGAAAAGCAGG + Intronic
1085163283 11:74369451-74369473 CTACCAGGGAAGTGTAGTGAAGG + Intronic
1085493493 11:76945684-76945706 CTTCTAAGCAAGTGAAGTGCAGG - Intronic
1085722544 11:78925471-78925493 TTTTCAGGGAAGGAAAATGCAGG + Intronic
1085979750 11:81709923-81709945 CTTCTTGAGAAGTGTAATGCGGG - Intergenic
1086204484 11:84241405-84241427 CTTCTAGGAAAGTGAGATTCAGG - Intronic
1087836457 11:102880003-102880025 GCTGCAGGGAAGTGAGATGCAGG + Intergenic
1087983722 11:104650831-104650853 TTTGCAGGAAACTGAAATGCAGG - Intergenic
1093187859 12:16042354-16042376 CTTTCAGGGAAGGCAAAGGCAGG - Intergenic
1093888815 12:24494593-24494615 CTTCCAGGGAAGAGTAAAGGTGG - Intergenic
1094575456 12:31680933-31680955 TTTCCAAGGAAGATAAATGCTGG - Intronic
1096199682 12:49672730-49672752 CTGCAGGGGAAGGGAAATGCCGG + Intronic
1099170254 12:79355451-79355473 CTTCCAGGTAATTCAAATGTAGG - Intronic
1100574344 12:95875699-95875721 CTTCTAGAGATGTGAAATGTGGG - Intronic
1101487151 12:105176294-105176316 ATTCCAGGTAAGTGAAACTCAGG + Intronic
1101845594 12:108360757-108360779 ATTCCAGGGAAGTGAGCTCCAGG - Intergenic
1103649851 12:122423470-122423492 GGTCCATGGGAGTGAAATGCTGG - Intergenic
1106871450 13:34026232-34026254 CTAACAGGAGAGTGAAATGCTGG - Intergenic
1107252594 13:38381976-38381998 CTTCCAAGGAAGTGAACTAAGGG - Intergenic
1108570066 13:51740801-51740823 CTCTCAGAGAAGTGAAATGCAGG + Intronic
1108583353 13:51846084-51846106 CTCCCAGGGGTGTGCAATGCAGG - Intergenic
1113901301 13:113799811-113799833 TTTCCAGGTGAGTGAGATGCGGG + Intronic
1114592997 14:23885816-23885838 CTTCCAGGGCAGTGGCATTCTGG + Intergenic
1116025135 14:39505743-39505765 CTTACAGGGAAGAGGTATGCTGG - Intergenic
1116059921 14:39910090-39910112 TTTCCAGGGAACAGAAATGAAGG - Intergenic
1116722921 14:48523862-48523884 CTTACAGGGAAATGAAATACTGG + Intergenic
1118456234 14:65947665-65947687 CTTCCTGGGAGGAGAATTGCTGG + Intergenic
1118931658 14:70247537-70247559 CTTCCAGGGAAGTGAAATGCTGG + Intergenic
1118953505 14:70457601-70457623 CTTCCGGGGAAGTGAAATGCTGG - Exonic
1118960380 14:70524634-70524656 CTTCTGGAGAAGTGAAATACTGG + Exonic
1119995486 14:79248881-79248903 CTCACAGGGGAGGGAAATGCAGG + Intronic
1120207119 14:81598922-81598944 CTTCCAGGGAAGTTCAGTGATGG + Intergenic
1120831244 14:88999659-88999681 TTTCAAGGGCAGTGAAAGGCAGG - Intergenic
1121226867 14:92327504-92327526 ATTCCAGGGACCAGAAATGCTGG + Intronic
1121275844 14:92667015-92667037 CTGCCAGGGAAGTGGATGGCAGG - Intronic
1121327784 14:93031582-93031604 CTTCCAGACAAGGGAAATGATGG - Intronic
1123698336 15:22895719-22895741 CTTCCTGGGAGGTGAAGGGCTGG + Intronic
1124188702 15:27552468-27552490 CTTCCATGGAAGGGGAATGGTGG - Intergenic
1127398968 15:58566186-58566208 CTTCCCGGGTTGTGTAATGCTGG - Intronic
1128792353 15:70442543-70442565 GTTCCAGAGACGTGAAATCCAGG + Intergenic
1129252530 15:74316693-74316715 CCTCCAGGGAAATGAAAGGGAGG - Intronic
1129523480 15:76200042-76200064 CTTCCAGGGACGTCAACTCCTGG - Intronic
1129642184 15:77392076-77392098 CTTCCTGGGCAGTGAGATACAGG + Intronic
1130896474 15:88174063-88174085 CCTCCAGGGAGGTGAGATGGGGG + Intronic
1131248241 15:90814393-90814415 CTGCAAGGAAAGTGAGATGCTGG + Intronic
1131364504 15:91827056-91827078 CTTCCAGGGAAGTGGGATGTAGG + Intergenic
1134044323 16:11090131-11090153 CTTCCAGGGAACCAGAATGCAGG - Intronic
1135301889 16:21336223-21336245 CTTCCAGAAAACTGAAATGGAGG - Intergenic
1136586812 16:31191619-31191641 CTTCCAGGAAAGTGAAAAGGGGG - Exonic
1137695623 16:50460322-50460344 CTTCCAGGGAAATGGAGTGGTGG - Intergenic
1137733473 16:50707163-50707185 GTTCCACAGAAATGAAATGCAGG - Intronic
1141672254 16:85498220-85498242 CTTCCACGGCACTGAACTGCTGG + Intergenic
1144345900 17:14349334-14349356 TTTCTAGGCAAGTGAAATTCTGG + Exonic
1146645835 17:34577074-34577096 TTTCCAGGTAAATGACATGCAGG + Exonic
1146984675 17:37203893-37203915 CTTCCAGAGAAGTGAAAGTAGGG - Intronic
1147364295 17:39950442-39950464 CTTCCAGGGGAATGAAATAAGGG + Intergenic
1149592459 17:57841505-57841527 CTTCCTGGGAAGGGAACTGGGGG - Intronic
1150117829 17:62569805-62569827 CATCCCAGGAACTGAAATGCGGG - Intronic
1151437511 17:74107196-74107218 GTTCCAGGGACCTCAAATGCGGG + Intergenic
1151537130 17:74745299-74745321 CTTCAAGGGAACTGAAATACCGG + Exonic
1152103585 17:78316417-78316439 CATCAAGGGGAGTGAACTGCGGG + Intergenic
1152431618 17:80251373-80251395 CTTCCAGGGTAGAGAAGTACTGG - Exonic
1153024762 18:662171-662193 CTTCCAAGGGAGTGAAAATCTGG + Exonic
1155994165 18:32312412-32312434 CTTACAGGACAGTGAAATGAGGG + Intronic
1156048191 18:32900901-32900923 GTTCTAGGGAAGTAAAAAGCAGG - Intergenic
1156154090 18:34281152-34281174 TTTCAAGGGCAGTCAAATGCGGG - Intergenic
1156393441 18:36675004-36675026 ATTCCAGGGAAAGGAAATACAGG - Intronic
1156640196 18:39085892-39085914 AGTACAGGGAAGTGAAATCCAGG - Intergenic
1156692088 18:39720397-39720419 CTTCCTGGGAAGTGACATGTAGG - Intergenic
1158668391 18:59453189-59453211 CTTCCAGGGAAGGAAAGTGAGGG + Intronic
1158785680 18:60709364-60709386 CTTCCAGGGAGGAGAAAATCAGG - Intergenic
1160051734 18:75440043-75440065 CTTCCAGGAAAGTGTTCTGCTGG + Intergenic
1160732028 19:645685-645707 ATCCCAGGGCAGTGAAATCCCGG + Intergenic
1161129599 19:2580094-2580116 CTCCCAGGGCAGGGGAATGCAGG + Intronic
1162483302 19:10942355-10942377 CTTCCATTGAAATAAAATGCAGG + Intergenic
1166042714 19:40213297-40213319 CTTCCTGGGAAGGGAGATGGTGG + Intronic
1168595390 19:57671453-57671475 CTTGGAGGGAAGTGAAATGAAGG + Intronic
927203908 2:20595044-20595066 CATTCAGGGAAGTGGCATGCCGG - Intronic
927965498 2:27265146-27265168 CTGCCCGGGAAGGGAAATCCCGG - Intronic
929442280 2:41973527-41973549 CATCCAGAGAAATGAAATTCTGG + Intergenic
935234655 2:101128368-101128390 CTTCCTGGGAAGAGTAATGAGGG + Intronic
935676450 2:105598496-105598518 CTTCTGGGAAAGTTAAATGCAGG - Intergenic
936038718 2:109132092-109132114 CTGCCAGGAAAGTTGAATGCTGG + Intronic
936814983 2:116449446-116449468 CTTTCATGGAGGGGAAATGCTGG + Intergenic
936895834 2:117426514-117426536 CTTAGAGGCAAGTAAAATGCAGG - Intergenic
937015116 2:118597927-118597949 CTTCCATGGAGGAGAAATGGAGG - Intergenic
937096940 2:119241707-119241729 CTTCCAGGGAGCTGATATGGAGG - Intronic
938096020 2:128464688-128464710 CTTCCTGAGAAGTGAAGTGAGGG - Intergenic
938111364 2:128568251-128568273 CTTCCAGCAAAGTGACAGGCAGG - Intergenic
938588767 2:132717151-132717173 CATCCAGGAAAGTGTAATGCTGG + Intronic
940020198 2:149148259-149148281 TTCCCAGGGAAAAGAAATGCAGG + Intronic
940021874 2:149164541-149164563 CTTCCAAGGAAGCCAAATTCAGG + Intronic
941322559 2:164073532-164073554 ATTCCAGGGAAGTGTTTTGCAGG + Intergenic
942838332 2:180328795-180328817 CTTGCAGGGAAGAGAAACACTGG - Intergenic
947041214 2:225922841-225922863 CTTCTAGTGAAGTGACATGTAGG - Intergenic
947578082 2:231292723-231292745 CTTGCAGGGATGTGGACTGCTGG - Intronic
948492680 2:238323441-238323463 GTTCCAGGAATGTTAAATGCAGG + Intronic
1170328349 20:15180629-15180651 CTTCTAGAGAAGAGAAAAGCTGG - Intronic
1170437121 20:16341752-16341774 CCTCCAGGGAACTGTGATGCAGG + Intronic
1172690134 20:36784358-36784380 CCTGCAGGGAAGGGAGATGCAGG + Exonic
1173387191 20:42599624-42599646 CATCCAGGGAAGGCAAATGAAGG - Intronic
1173575350 20:44109887-44109909 CTTCCAGGGCAGTGAAAGGGAGG - Intergenic
1174006106 20:47412038-47412060 CCTCCAGGGAACTGAGAAGCTGG + Intergenic
1174944903 20:54974272-54974294 CTTGCAGGAAAGTGTAGTGCAGG + Intergenic
1175051973 20:56164096-56164118 CTTCCAGGAAAGGGAAAGGCAGG + Intergenic
1176239034 20:64067458-64067480 CTGCCAGGGAAGGGAAGGGCTGG + Intronic
1176690730 21:9905019-9905041 CTTCCAGCCATGTGAAGTGCTGG - Intergenic
1179110648 21:38442475-38442497 CTGTCAGGCAAGTGAAAGGCTGG - Intronic
1182203905 22:28603305-28603327 CTTCCAGAGAATTGAAATTAAGG + Intronic
949932769 3:9092112-9092134 ATTGCAGGGAAAGGAAATGCTGG - Intronic
950251344 3:11468332-11468354 CTTCCAGGGAAGTGGCGGGCTGG - Intronic
951700052 3:25487217-25487239 CTTCCATGGAAGCGAAAACCTGG - Intronic
951701682 3:25503214-25503236 CTTCCACTGAAGAGAAAAGCAGG + Intronic
954259140 3:49426116-49426138 CTTCCAGGGAAGTGCCTTGGAGG - Intronic
954789388 3:53120214-53120236 CTTCCAGTTAAGTGAAGTGTTGG - Intronic
955507752 3:59648805-59648827 CTTCCAGGGAAAAGATAAGCTGG + Intergenic
956097608 3:65733903-65733925 CTCCCAGGGAAGGGCAATGCAGG + Intronic
956624555 3:71254235-71254257 CTTACAGGGAAGACAAAAGCAGG - Intronic
957223332 3:77412288-77412310 CTTCCAAGGAAGTTGCATGCTGG + Intronic
957354004 3:79058718-79058740 CTTCAAGAAAAGTGTAATGCTGG + Intronic
958927178 3:100171516-100171538 CTGCCAGGGACCTGAAATACAGG + Intronic
961081156 3:124029627-124029649 CTTCCAGAAAAGTGAAAAGGAGG - Intergenic
962128233 3:132645414-132645436 GGCCCAGGGAAGTGCAATGCTGG + Intronic
962968000 3:140371873-140371895 CTGCCTGGGAAGGGAAATGTAGG - Intronic
963843688 3:150133333-150133355 CCTCCAGGGAAGTGAGAAGCAGG + Intergenic
967542090 3:190679799-190679821 CTTCCAGGGAAGTCATCTGAGGG + Intergenic
968767583 4:2481659-2481681 CTCCCAGGGAAGATAAAAGCAGG - Intronic
974319852 4:60333488-60333510 CTTCTTGGGAAGTGAAATAAAGG + Intergenic
976878606 4:89889894-89889916 CTTCCAAGGTATAGAAATGCAGG - Intronic
976885639 4:89980300-89980322 CTTGGAGGTAAGTGAAATGCTGG - Intergenic
977741339 4:100487205-100487227 CTTCCAACGAAGTAAGATGCTGG + Intronic
977741349 4:100487277-100487299 CTTCCAAGGAAGTAAGATGCTGG + Intronic
980363307 4:131765247-131765269 CTTCCAGCCATGTGAAGTGCTGG - Intergenic
981499383 4:145433287-145433309 CTTCCAGGAAAGTAAAAGGGAGG - Intergenic
982996623 4:162356705-162356727 CTTCCACCTAAGTGAAATGTTGG - Intergenic
986573425 5:9188852-9188874 TTTTCAGGGAAGGGAAATGGAGG - Intronic
987170551 5:15252943-15252965 CTTCTAGGGAAGTAAGATGTGGG + Intergenic
991042129 5:62187232-62187254 TTTCCTGGGTAGGGAAATGCTGG + Intergenic
991045589 5:62219074-62219096 CTTCCAGGCAGATGAAGTGCAGG + Intergenic
993620328 5:90160884-90160906 CTTCCTGGGAAGAGCAATGGAGG - Intergenic
994414250 5:99448139-99448161 CTTACAAGGAAGTGACAGGCAGG + Intergenic
996283105 5:121756107-121756129 GTTCTAGAGAAGTGAAATGGAGG - Intergenic
997720624 5:136075820-136075842 CTGCCAGGGAGATGCAATGCAGG + Intergenic
997803282 5:136888467-136888489 CTTCCAGGGCAGGGAAGAGCTGG + Intergenic
999632823 5:153588101-153588123 CTGCCAGGATAGTGAAAAGCAGG + Intronic
999904264 5:156122249-156122271 CTATCAGTGAAGTGAAGTGCTGG + Intronic
1004180928 6:13379861-13379883 CAGACAGGGAAGTGAAATGAGGG + Intronic
1005487982 6:26319527-26319549 CTTGCGGGGCAGTGCAATGCTGG - Intergenic
1005618555 6:27599214-27599236 CTGACAGGGAAGTCAAATGCTGG + Intergenic
1008625701 6:53314230-53314252 CTTGCAGAGAATTGAAATGAAGG - Intronic
1009381267 6:63033463-63033485 CTTGTAGGTTAGTGAAATGCAGG - Intergenic
1013916433 6:115344025-115344047 ATGCCAAGGAAGGGAAATGCTGG - Intergenic
1015765381 6:136710725-136710747 CTTTCAGGAAGGTGAAATCCTGG - Intronic
1015954709 6:138587739-138587761 CTTCCAAGGCAGTGAATTTCAGG - Intronic
1015993375 6:138971817-138971839 CACCCAGGGAAGTGAAAAGTGGG - Intronic
1018251981 6:161880747-161880769 CTTCAATGGAAATGAAAAGCAGG - Intronic
1022102195 7:27175211-27175233 ATTTCGGGGAAGTAAAATGCTGG + Intronic
1022945873 7:35282922-35282944 CTCCTAGGGAAGTGGAATGTTGG - Intergenic
1024331580 7:48160528-48160550 CTGACAGGGAAGGGAAGTGCAGG + Intergenic
1025096593 7:56100433-56100455 CTGCCAGGTGAGTGAAATGCTGG - Intergenic
1026012040 7:66644141-66644163 CTCCCAGGGATGTGAACTGTGGG - Intronic
1029746179 7:102516944-102516966 GGTTCAGAGAAGTGAAATGCTGG - Intronic
1029764117 7:102615923-102615945 GGTTCAGAGAAGTGAAATGCTGG - Intronic
1029966109 7:104742649-104742671 CTTCCTGGCCTGTGAAATGCAGG + Intronic
1031742925 7:125456888-125456910 CTTCCAGGGAACAGAAATTTAGG - Intergenic
1034559033 7:151867926-151867948 CTTCCAGGGGAGTTCATTGCTGG - Intronic
1034639074 7:152587962-152587984 CTTCCAGAGAATTGAAAAGTAGG - Intergenic
1035421816 7:158735901-158735923 CTTCCAGGGGATTAAAATGTGGG + Intronic
1036297579 8:7549469-7549491 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1036298883 8:7557116-7557138 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1036300188 8:7564766-7564788 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1036806600 8:11838739-11838761 CCTTTAGGAAAGTGAAATGCAGG + Exonic
1036882994 8:12528622-12528644 CTTCCTGAGAACTGAGATGCGGG + Intergenic
1038848848 8:31254857-31254879 CTGCCAGGGAAGGGAAAGGGAGG - Intergenic
1039826965 8:41182923-41182945 CTTCCAGGGAAAGGAAATGTTGG - Intergenic
1040010754 8:42659273-42659295 CACCGAGGGAAGTGAAATGGAGG + Intergenic
1041615073 8:59897198-59897220 CTTCCAGGGGTGTGAAATGCAGG + Intergenic
1046338585 8:112823170-112823192 ATTCCAGGGAGTTGAAATGGAGG - Intronic
1048240830 8:132740245-132740267 AATCCAGGCAAGTGAAATGCTGG - Intronic
1048249505 8:132850120-132850142 GTTCCAAGGAATTGAAATGAGGG + Intergenic
1048343221 8:133556420-133556442 CTTTCAGAGGAGTGAGATGCTGG + Intronic
1048519905 8:135143819-135143841 CTTTCAGGGTAGGGAAATTCTGG - Intergenic
1049436618 8:142589108-142589130 CCTCCAGGGAACTGAGGTGCAGG + Intergenic
1051167509 9:14280059-14280081 CTTCCTGGGAAATAAAATCCTGG - Intronic
1052250217 9:26389575-26389597 CTTCTTGGGAAGTGGAATACAGG + Intergenic
1053210296 9:36222022-36222044 CCTCCAGGGAGGTGACAGGCAGG - Intronic
1053627462 9:39889533-39889555 CTTCCAGCCATGTGAAGTGCTGG - Intergenic
1053778529 9:41576488-41576510 CTTCCAGCCATGTGAAGTGCTGG + Intergenic
1054166491 9:61786732-61786754 CTTCCAGCCATGTGAAGTGCTGG + Intergenic
1054216425 9:62361170-62361192 CTTCCAGCCATGTGAAGTGCTGG + Intergenic
1054671056 9:67794173-67794195 CTTCCAGCCATGTGAAGTGCTGG - Intergenic
1056810908 9:89763242-89763264 CTACCAGGGAAGCTAAATGTGGG + Intergenic
1057163378 9:92907218-92907240 CTTCCAGGGAACAGAAATTTTGG - Intergenic
1058148867 9:101442402-101442424 CTTCCAGGAAAGTGTAGTTCTGG - Intergenic
1060688231 9:125631790-125631812 CTTCTAGGTAGGTGAAGTGCTGG - Intronic
1185867620 X:3637409-3637431 CTTCCAGGAAAATGTACTGCAGG + Intronic
1186413468 X:9363431-9363453 CTTCAAAGAAAGTAAAATGCAGG + Intergenic
1187289746 X:17941724-17941746 CTTCCAGAAAAGAGAAATTCTGG + Intergenic
1187290638 X:17950089-17950111 CTTGCAGGCAAGTGAAATATGGG - Intergenic
1189275263 X:39780808-39780830 TTTCTAGGGAAGAGAAATGCTGG - Intergenic
1189660219 X:43288518-43288540 TTTCCAGAGAACTGAAATGGTGG - Intergenic
1189744474 X:44156075-44156097 TTTCCTTGGAAGTGCAATGCAGG + Intronic
1192233091 X:69279142-69279164 CTTCCAGGGAAGGGAAACAGAGG + Intergenic
1193078461 X:77381115-77381137 CTTCCACAGAAGGGACATGCGGG + Intergenic
1195716016 X:107819399-107819421 CTCCTAGGGCAGTGAAATGTGGG + Intergenic
1195872351 X:109499573-109499595 CTTCCAGTGAGGTGAACTTCAGG - Intergenic
1196647162 X:118130552-118130574 CTTTCAGTGGAGTGAAATTCAGG + Intergenic
1196730030 X:118931715-118931737 CTTCCAGGAAATTGAAAGGAAGG - Intergenic
1197655043 X:129107657-129107679 CTTCCTTGGAAGTATAATGCTGG - Intergenic
1199085227 X:143620575-143620597 GTTTTAAGGAAGTGAAATGCAGG - Intergenic
1200030932 X:153294840-153294862 CTTGTAGGTAAGTGACATGCAGG - Intergenic
1200531840 Y:4348766-4348788 CTTCCTGGGAACTGAAATAAAGG - Intergenic
1202037723 Y:20651319-20651341 CTTACAGGGGAGTAACATGCAGG - Intergenic