ID: 1118931659

View in Genome Browser
Species Human (GRCh38)
Location 14:70247538-70247560
Sequence TTCCAGGGAAGTGAAATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931647_1118931659 23 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931654_1118931659 -4 Left 1118931654 14:70247519-70247541 CCTTCAAGGGGATCACCACTTCC No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931651_1118931659 8 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931653_1118931659 7 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931649_1118931659 9 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274
1118931646_1118931659 30 Left 1118931646 14:70247485-70247507 CCAGGAGCCTTTGCACTTCTGCC No data
Right 1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931659 Original CRISPR TTCCAGGGAAGTGAAATGCT GGG Intergenic
900548905 1:3243850-3243872 TTCCAGGGAGGTGAAGTCCCTGG + Intronic
902732868 1:18381185-18381207 TTCTAGAGAAGGGGAATGCTAGG - Intergenic
906331497 1:44888845-44888867 TTCCAGGGAACAGGAATTCTGGG + Intronic
908150908 1:61301833-61301855 TTCAAGGGGAGTGAAATGGTAGG + Intronic
908445785 1:64198402-64198424 TTGCAGAGATGTGAAAAGCTGGG - Intergenic
908564493 1:65340583-65340605 TTCCAGTGAAGTTAAATGACTGG - Intronic
908716318 1:67073819-67073841 TTCCTGGGAAGGGAAAGACTTGG - Intergenic
910549869 1:88463330-88463352 TTCGAGGGAAGGGAATTGGTGGG - Intergenic
912809581 1:112783832-112783854 GCCCAGGGAAGTGAAAAGATTGG - Intergenic
913585062 1:120266934-120266956 TTAAAGAGAAGTGAAATTCTAGG + Intergenic
913623121 1:120631428-120631450 TTGAAGAGAAGTGAAATTCTAGG - Intergenic
914336892 1:146723633-146723655 TTCCTTGGAAGCGAATTGCTGGG - Intergenic
914567066 1:148878795-148878817 TTAAAGAGAAGTGAAATTCTAGG + Intronic
914605758 1:149251447-149251469 TTAAAGAGAAGTGAAATTCTAGG - Intergenic
915209209 1:154294644-154294666 TTGCAGGAAAGTGAACAGCTGGG + Intergenic
916263889 1:162870047-162870069 TTTTAGAAAAGTGAAATGCTCGG + Intergenic
918668896 1:187187835-187187857 TTGCAGGGAAGTGTAAAGCCAGG + Intergenic
921814936 1:219552741-219552763 GTCCAGGGACTTGAATTGCTTGG + Intergenic
923058028 1:230443072-230443094 TTCCAGAGGAGAGAAACGCTGGG + Intergenic
923704248 1:236331168-236331190 ATCCAGGGAAGAGAAAAGCCTGG - Intergenic
924371374 1:243354142-243354164 TCCCAGTGAAGTGAGAAGCTTGG + Intronic
924648457 1:245902082-245902104 TTCCAGGGATGTGGAATGGAGGG - Intronic
1064310934 10:14211106-14211128 TACCAGGGAAGTGAGATGGGGGG - Intronic
1065948695 10:30630679-30630701 TTCCTGGAAATTGAATTGCTGGG + Intergenic
1066216482 10:33293245-33293267 TTCCAGGGAAGGAAAAGCCTGGG - Intronic
1067733380 10:48830170-48830192 TTCCAGGGGACTGAAATGGGTGG + Intronic
1067734550 10:48839099-48839121 TCCCAGGGAAGTGAAATCTGAGG - Intronic
1067767847 10:49101725-49101747 TTCCTGGAAAGGGAATTGCTGGG - Intronic
1068858540 10:61823070-61823092 TTCCAGAGAAGGGAAATACCAGG + Intergenic
1070457721 10:76633679-76633701 CTGCAGAGAAGTCAAATGCTTGG - Intergenic
1071211296 10:83344574-83344596 TTCCAGGAAATTGAAAAGCCAGG + Intergenic
1072156448 10:92728321-92728343 GCCCAGGGAAGTGAAAAGATTGG - Intergenic
1074766018 10:116700637-116700659 TACCAGGGAAGTGGGGTGCTGGG - Intronic
1074766516 10:116703935-116703957 TTCAAGTGAAGAGAAGTGCTGGG - Intronic
1075849125 10:125573463-125573485 CTGCAGGGAAGTACAATGCTCGG - Intergenic
1075985439 10:126781026-126781048 TTTCAGGGAACTGAAATGTCAGG - Intergenic
1079273596 11:19012690-19012712 TTTTAGGAATGTGAAATGCTAGG - Intergenic
1079538428 11:21543011-21543033 TTCCAGGGAAGAGACATGTCAGG + Intronic
1080415538 11:32066647-32066669 GTCCAGGGAAGTCAAAAGATTGG - Intronic
1080504830 11:32902251-32902273 TGCCAGGGAAGGGAACTGCCAGG - Intronic
1080853182 11:36089163-36089185 TTCAGGGCAAGTGAACTGCTTGG + Intronic
1083194577 11:61077539-61077561 TTCCCAGGAACTGAATTGCTGGG - Intergenic
1083224528 11:61276576-61276598 TTCCAGGTAAGTGACACTCTTGG - Exonic
1086398691 11:86443054-86443076 TACCAGGGAAGCTTAATGCTTGG + Intronic
1087268250 11:96084166-96084188 GTCAAGGGAAGAGAAAGGCTGGG + Intronic
1087524888 11:99297133-99297155 TGCCAGGGAACAGAAATGTTAGG - Intronic
1087836458 11:102880004-102880026 CTGCAGGGAAGTGAGATGCAGGG + Intergenic
1089871414 11:121675840-121675862 CTCAAGGGAAGTGAAATGAATGG - Intergenic
1090884958 11:130867837-130867859 GTCCAGGGAAGTGAAGAGATCGG + Intergenic
1091133292 11:133165023-133165045 TTCAAGGGAAATGAAATCCATGG - Intronic
1091149143 11:133310665-133310687 TTCCAGGGAAGGATAGTGCTTGG - Intronic
1091838045 12:3599770-3599792 TTCCAGGGGAGCAGAATGCTTGG + Intergenic
1092791987 12:12078343-12078365 ATTCAGGGAAGAGAAATGCCTGG - Intronic
1093888814 12:24494592-24494614 TTCCAGGGAAGAGTAAAGGTGGG - Intergenic
1093910045 12:24736653-24736675 TTCCTGAGAAGGGAAAAGCTAGG + Intergenic
1096230314 12:49893144-49893166 ATACAGGGAAGTCAAATGATTGG - Intronic
1098219084 12:68249447-68249469 GTCCAGGGAAGCCAAATGATTGG + Intronic
1098366456 12:69708466-69708488 TTCCTGGAAACTGAATTGCTGGG - Intergenic
1098942163 12:76550497-76550519 GTCCAGGGAAGCCAAATGATTGG - Intronic
1099251773 12:80264920-80264942 TTCTAAGAACGTGAAATGCTTGG + Intronic
1099554748 12:84097572-84097594 TTCCAGGGGAGTGAACAGTTCGG - Intergenic
1100392929 12:94159694-94159716 TTGAAGGGAAGTGAAATGATTGG + Intronic
1101488029 12:105185251-105185273 TTCCAGGGGAGTGAACAGTTGGG + Intronic
1104864794 12:131946788-131946810 GTCCAAGTAAGTGAAATGATGGG - Intergenic
1108422583 13:50266004-50266026 CTCCAGGGAAGTGAAAGTTTGGG + Intronic
1108463334 13:50690192-50690214 TTCCAGGCATATTAAATGCTTGG + Intronic
1111104802 13:83630861-83630883 TGTCAGGGAAGTTAGATGCTGGG + Intergenic
1111281801 13:86036071-86036093 TTTCAGGAAAATGAAATGATAGG + Intergenic
1112394595 13:99017649-99017671 GTCCAGGGAAGTCAAAAGATTGG - Intronic
1113901302 13:113799812-113799834 TTCCAGGTGAGTGAGATGCGGGG + Intronic
1117336976 14:54764280-54764302 TTCCACAGAAGTCAAAGGCTGGG - Intronic
1117513470 14:56476212-56476234 TTTCAGGAAAGTGAAATTGTTGG + Intergenic
1118931659 14:70247538-70247560 TTCCAGGGAAGTGAAATGCTGGG + Intergenic
1118953504 14:70457600-70457622 TTCCGGGGAAGTGAAATGCTGGG - Exonic
1118960381 14:70524635-70524657 TTCTGGAGAAGTGAAATACTGGG + Exonic
1119087232 14:71749800-71749822 TGCCAGGGAAGTGATGTGCCAGG + Intergenic
1119552695 14:75526371-75526393 TTCCATGGAAAGGAATTGCTAGG - Intronic
1120698297 14:87669085-87669107 TTCCATGGAAATGAAATGAAAGG + Intergenic
1124037455 15:26068857-26068879 TTCCAGGCAAGGGAACTGCATGG - Intergenic
1125588989 15:40843356-40843378 TTCCAGGGAAATGTCATCCTTGG - Intergenic
1126890446 15:53198961-53198983 TTTCAGGTAAGTGAACTACTTGG - Intergenic
1128722036 15:69957264-69957286 CTCCAGGGAGGTGGAATGGTTGG + Intergenic
1130045161 15:80437749-80437771 TCGAAGGTAAGTGAAATGCTCGG - Intronic
1134636347 16:15794791-15794813 GTCCAAGGGAGGGAAATGCTGGG + Intronic
1135083593 16:19457010-19457032 GTTCAAGGTAGTGAAATGCTGGG + Intronic
1135383548 16:22014426-22014448 GTTCAGGGAAGTGAAAGCCTTGG + Intronic
1136651723 16:31678616-31678638 TTCCCCAGAACTGAAATGCTTGG + Intergenic
1136671337 16:31861365-31861387 TTCCCCAGAACTGAAATGCTTGG + Intergenic
1137695622 16:50460321-50460343 TTCCAGGGAAATGGAGTGGTGGG - Intergenic
1137996497 16:53220527-53220549 TGACAAGGAAGTGAAATGCAAGG - Intronic
1139997379 16:70993686-70993708 TTCCTTGGAAGCGAATTGCTGGG + Intronic
1141672255 16:85498221-85498243 TTCCACGGCACTGAACTGCTGGG + Intergenic
1144582794 17:16469246-16469268 TTGCAAGGAAATGAAATGCTAGG - Intronic
1146072302 17:29694168-29694190 GTCCAGGGAAGCCAAATGATTGG + Intronic
1146719249 17:35112020-35112042 TTTCAGAGAAATGAAATACTTGG - Intronic
1147262439 17:39216534-39216556 ATCCAGAGAAGGGAAATGGTAGG + Intronic
1147977284 17:44255127-44255149 TTCTAGGGAAGGGGCATGCTGGG + Intronic
1148341695 17:46877096-46877118 TTCTTGGGAGGTGAACTGCTGGG + Intronic
1148973289 17:51503751-51503773 TTCTAGGCAAGTGATATCCTTGG + Intergenic
1149163722 17:53725428-53725450 TACCTGGGAAGAGAACTGCTGGG + Intergenic
1149262094 17:54891153-54891175 GTCCAGGGAAATGAGTTGCTTGG - Intergenic
1150563129 17:66312324-66312346 ATCCAGGAGAGTGAAATACTCGG - Intronic
1151090686 17:71436791-71436813 TTTCTAGGAAGTGAACTGCTAGG + Intergenic
1151422144 17:74005538-74005560 TTCTAGAGAAGTGGAAGGCTGGG + Intergenic
1151537131 17:74745300-74745322 TTCAAGGGAACTGAAATACCGGG + Exonic
1152987885 18:336126-336148 TTACAGGGAAGTTATAGGCTTGG - Intronic
1153024763 18:662172-662194 TTCCAAGGGAGTGAAAATCTGGG + Exonic
1155133357 18:22961730-22961752 TTCCAGGGAAGCCAAAAGATTGG + Intronic
1155900470 18:31382827-31382849 GGCCAGGGAAGTGGAATACTAGG - Intronic
1156048190 18:32900900-32900922 TTCTAGGGAAGTAAAAAGCAGGG - Intergenic
1157403419 18:47404697-47404719 ATCCAGTGAAGTGCAAAGCTGGG - Intergenic
1157812719 18:50709271-50709293 TTCCAAGGAAGTGCAGTGCCAGG + Intronic
1161925444 19:7295513-7295535 TTACGGGCAAGGGAAATGCTGGG - Intergenic
1162564259 19:11436410-11436432 GTCCAGGCAGGTGAAAGGCTTGG - Exonic
1163101465 19:15099663-15099685 GTCCAGGGAAATGAAAAGATTGG - Intergenic
1163598597 19:18234452-18234474 TTCCTGGGAAGTGCAAGGATGGG + Intronic
1165656185 19:37534209-37534231 TTCCTTGGAAGGAAAATGCTGGG - Intronic
1167976980 19:53235678-53235700 TTTCATGGAAGTGAAATGGTCGG - Exonic
1168573603 19:57490287-57490309 TTCCAGGGAACTCAAATGGAAGG - Intronic
1168595391 19:57671454-57671476 TTGGAGGGAAGTGAAATGAAGGG + Intronic
925652594 2:6107302-6107324 TATCAGAGAAGTCAAATGCTGGG - Intergenic
928630173 2:33183414-33183436 TTTCAGAGAAGTGACATGATTGG + Intronic
928836509 2:35553575-35553597 TTCCATGGGAGTGAAATTGTTGG + Intergenic
929208429 2:39325339-39325361 TTCATGGAAAGTCAAATGCTAGG - Intronic
929520759 2:42648276-42648298 TTGCAGGGAAGTTAAATAGTAGG + Intronic
930251102 2:49034837-49034859 CTCCAGGGGTGAGAAATGCTAGG - Intronic
933614317 2:84468828-84468850 TTCCAGGGAACAGAAATTTTAGG - Intergenic
934888984 2:98049096-98049118 TTCCAGGGAACAGAAATTTTAGG + Intergenic
936814984 2:116449447-116449469 TTTCATGGAGGGGAAATGCTGGG + Intergenic
937041632 2:118825564-118825586 TTTCAGGGAAATGGAAAGCTAGG - Intergenic
937340297 2:121086862-121086884 GCTCAGGGAAATGAAATGCTGGG - Intergenic
938588768 2:132717152-132717174 ATCCAGGAAAGTGTAATGCTGGG + Intronic
939280090 2:140052808-140052830 TACCCGGGAATTGAATTGCTGGG - Intergenic
940462406 2:153982178-153982200 TTTTAGTTAAGTGAAATGCTAGG + Intronic
942232100 2:173870138-173870160 GCCCAGGGAAATGAAAGGCTGGG - Intergenic
944048675 2:195440976-195440998 TTGCTGGGAATGGAAATGCTAGG - Intergenic
944476551 2:200112440-200112462 TTCCAGGGACCTGAAGTCCTAGG + Intergenic
944941096 2:204628073-204628095 TTCCAGGGAAGCCAAAAGATTGG + Intronic
946511661 2:220364413-220364435 TGCCAGGTAAGTCAAATGCCTGG - Intergenic
947578081 2:231292722-231292744 TTGCAGGGATGTGGACTGCTGGG - Intronic
1169627106 20:7583212-7583234 TTCCAGGGAAATAAAATAATAGG + Intergenic
1169864606 20:10186413-10186435 TAGGAGGGCAGTGAAATGCTGGG - Intergenic
1170328348 20:15180628-15180650 TTCTAGAGAAGAGAAAAGCTGGG - Intronic
1173216476 20:41089650-41089672 TTCCTGGGAATGGAATTGCTGGG + Intronic
1173399648 20:42713200-42713222 CTCCAGGGAAGAGAAATGTGTGG + Intronic
1173575349 20:44109886-44109908 TTCCAGGGCAGTGAAAGGGAGGG - Intergenic
1174006107 20:47412039-47412061 CTCCAGGGAACTGAGAAGCTGGG + Intergenic
1174121731 20:48271020-48271042 TCCCAGGGAACTGGGATGCTAGG - Intergenic
1174906345 20:54556180-54556202 TGACAGGGAAATGAAATGCATGG - Intronic
1175357760 20:58382369-58382391 TTGGAGGTAATTGAAATGCTCGG + Intergenic
1176239035 20:64067459-64067481 TGCCAGGGAAGGGAAGGGCTGGG + Intronic
1176678331 21:9801866-9801888 GTCCAGTGAAATTAAATGCTTGG + Intergenic
1178116877 21:29426877-29426899 TTCCGGGGATGGGAAATGGTGGG + Intronic
1182933314 22:34195511-34195533 CTCCAGGGAGGTGAAATTGTGGG - Intergenic
951202168 3:19887559-19887581 GTCCAGGGAAGCCAAATGGTTGG - Intronic
952069572 3:29617906-29617928 ATCCAGGGAAGTGAAGTCATGGG + Intronic
952123883 3:30276554-30276576 TTCCAGGGAACAGAAATTTTTGG + Intergenic
952279762 3:31911518-31911540 GTCCAGGGAAGTAAAAAGATTGG - Intronic
952928555 3:38341265-38341287 GCCCAGGGAAGTGAAAAGATTGG - Intergenic
953698100 3:45175472-45175494 CTCCAGGGATGTGATATGGTCGG + Intergenic
954789387 3:53120213-53120235 TTCCAGTTAAGTGAAGTGTTGGG - Intronic
955263534 3:57419252-57419274 TTTCAGGTAACTGAAATCCTGGG - Intronic
955863482 3:63357106-63357128 TTCCAGGTATGTGAGAAGCTAGG - Intronic
956411351 3:68983153-68983175 ATTCAGGGAAGTAAAGTGCTAGG + Intronic
957724561 3:84047267-84047289 TTCCAGGGAAGAGGAATTTTAGG + Intergenic
958124039 3:89332545-89332567 TTCCAGTGTATTGAAATGCCTGG + Intronic
958636803 3:96755538-96755560 TTCCAGGAAAGAGATATGTTCGG - Intergenic
959385629 3:105701980-105702002 TTACAGGGAAGTGCCATGCTAGG + Intronic
961767765 3:129225341-129225363 TTGCAGGGAAATGATCTGCTTGG - Intergenic
961984924 3:131122178-131122200 TTCCAGGGAAGAGCCATACTTGG + Intronic
962042726 3:131723929-131723951 GTCCAGGGAATTGAAATGAGTGG + Intronic
962605255 3:137027464-137027486 TTCCTGGGTAATAAAATGCTTGG + Intergenic
963024514 3:140905660-140905682 TTCCAGGGAAGCCAAAAGATTGG + Intergenic
963204777 3:142621795-142621817 TTCCTGTGAAGTGAAGTCCTGGG + Intronic
965078565 3:164009074-164009096 TTCCATGAAAGTGATATGTTTGG - Intergenic
967769339 3:193317135-193317157 TTGCAGGGAATAGAAATGGTGGG - Intronic
970046021 4:11855269-11855291 GCCCAGGGAAGTGAAAAGATTGG + Intergenic
970331816 4:14994306-14994328 TTCCAGGAATGTGAAAGGCAAGG + Intergenic
970540746 4:17076552-17076574 TCCCAGGGTATTGAAATGTTAGG - Intergenic
970979705 4:22082029-22082051 TTCCAGGTAAGTGAATTGAGAGG + Intergenic
971672184 4:29576061-29576083 TTTCAGGGAAGGTAGATGCTTGG + Intergenic
975085592 4:70334768-70334790 TTCCCTGCAATTGAAATGCTTGG + Intergenic
975764656 4:77654892-77654914 TTCCAGGGGAGTGAATGGTTAGG - Intergenic
976866499 4:89734142-89734164 TTCCAGGGAAGTGAAAGTGAAGG + Intronic
976885638 4:89980299-89980321 TTGGAGGTAAGTGAAATGCTGGG - Intergenic
977741340 4:100487206-100487228 TTCCAACGAAGTAAGATGCTGGG + Intronic
977850181 4:101817918-101817940 GTCCAGGGAAGTCAAAAGATTGG + Intronic
978333615 4:107642917-107642939 TACCAGGGAGGAGAATTGCTAGG - Intronic
979109376 4:116732657-116732679 TTCCATGTGAGTTAAATGCTAGG + Intergenic
981890080 4:149726050-149726072 TTAGAGGGAAGAGAAATGGTTGG - Intergenic
984030740 4:174600831-174600853 TTCCATAGAATAGAAATGCTTGG - Intergenic
984976155 4:185231985-185232007 TTCCTTTGAAGTGAAAAGCTGGG - Intronic
985397228 4:189557103-189557125 GTCCAGTGAAATTAAATGCTTGG - Intergenic
986174746 5:5342158-5342180 TTCCACTGATGTGAAATGCCTGG - Intergenic
987187440 5:15439147-15439169 TACCCGGGAATAGAAATGCTGGG - Intergenic
987298351 5:16574350-16574372 GAGCAGGGAAGTGAAATGATGGG + Intronic
987682298 5:21153296-21153318 TTCCAGATGAGTGAAATTCTGGG - Intergenic
988772611 5:34447794-34447816 TTCCAGGGGAGTGAATGGTTCGG + Intergenic
990661842 5:58024235-58024257 TTACAATGAAGTGAAATGGTAGG + Intergenic
991970420 5:72135672-72135694 TTCCAGGGAAACTAGATGCTAGG - Intronic
994285461 5:97959471-97959493 TTCCTGGGAACAGAATTGCTAGG + Intergenic
995766498 5:115625443-115625465 TTAGAGGAAAGTCAAATGCTGGG + Intronic
999208009 5:149863923-149863945 TTCCAGCAAAGTGAACAGCTTGG - Intronic
999582848 5:153058907-153058929 TTCCATGGATGTGAAATCATAGG + Intergenic
1000280899 5:159781050-159781072 TTCCAGTGATATGATATGCTGGG - Intergenic
1001025692 5:168222567-168222589 GTCCTGGGAAGTGAAGAGCTGGG + Intronic
1001591402 5:172867734-172867756 ATGCAGGGAAGGGAAATGGTGGG - Intronic
1002530847 5:179843938-179843960 TTGCAGGGTATTGTAATGCTTGG + Intronic
1003134252 6:3421297-3421319 TTCCAAGAAAGGGAATTGCTGGG - Intronic
1004318020 6:14608513-14608535 CTCCAGAGAAGTGAAAAGCCAGG - Intergenic
1004822149 6:19379000-19379022 TTCCATGGAAGTAAAATCTTTGG - Intergenic
1005609161 6:27506824-27506846 GTTCTGGGAATTGAAATGCTTGG + Intergenic
1007713695 6:43841044-43841066 TTCCAGGGAGTAGAATTGCTGGG + Intergenic
1008424233 6:51338203-51338225 TTCCAGGGAAGTCAAAAGACTGG - Intergenic
1008730944 6:54481570-54481592 AGCAAGGGAAGGGAAATGCTGGG - Intergenic
1012751067 6:103164367-103164389 ATCCAGGGAAGTGTAATTCCTGG - Intergenic
1012857830 6:104523915-104523937 GTCCAGAGAAGTGAAATGATTGG + Intergenic
1013697544 6:112721698-112721720 TTGCAGGGAACTGCAATGGTTGG + Intergenic
1013739896 6:113270278-113270300 TCCCAGGGAAGTCAAAAGATTGG + Intergenic
1013910321 6:115268486-115268508 TTCCAGTTAAGTAAAATTCTTGG + Intergenic
1013916432 6:115344024-115344046 TGCCAAGGAAGGGAAATGCTGGG - Intergenic
1013953790 6:115817406-115817428 TTGCAGGGAAGGGTAATGATGGG + Intergenic
1014418307 6:121211362-121211384 TACCAGGGAAATGAAATCCCTGG + Intronic
1016887082 6:148968579-148968601 TTCCAGGGTAGGGAAATACCTGG + Intronic
1017490995 6:154945113-154945135 TCCCAGGGGAGTGACATGGTTGG - Intronic
1017519204 6:155186627-155186649 TTCCTGCCAAGTGAAACGCTGGG - Intronic
1019098954 6:169611799-169611821 TTCAGGGGCAGTGAAATGCATGG + Intronic
1020339008 7:7089267-7089289 TTCCAGGGAAGTGAATGGTTCGG + Intergenic
1020694018 7:11392529-11392551 TTCCAGGGGAGTGAATAGTTCGG - Intronic
1022338728 7:29448464-29448486 AAGCAGGGAAGTGACATGCTGGG - Intronic
1022367026 7:29731283-29731305 TTCCAAGAATGTGAAATGCCAGG - Intergenic
1022454783 7:30548876-30548898 TCCCTGGGAAGAGAAATGTTTGG - Intronic
1022929142 7:35092583-35092605 TTCCAAGAATGTGAAATGCCAGG + Intergenic
1022945872 7:35282921-35282943 TCCTAGGGAAGTGGAATGTTGGG - Intergenic
1023478122 7:40603043-40603065 TTCTAGGGAAGTTAAATTCTAGG + Intronic
1023680118 7:42676894-42676916 TTTGAGGGACGGGAAATGCTGGG + Intergenic
1023922428 7:44639849-44639871 TCCCCGGGAAGGAAAATGCTGGG - Intronic
1024230735 7:47361344-47361366 TGCCAGGGAAGTTCAGTGCTGGG - Intronic
1027501087 7:78951937-78951959 TTGCAGGCATGTGAAATGTTAGG - Intronic
1027857365 7:83529701-83529723 ATCCATTGAACTGAAATGCTAGG + Intronic
1028773174 7:94650390-94650412 TTCCAGGAAAGAGTAATTCTAGG + Intronic
1028881851 7:95888979-95889001 TTCAAGGAATGAGAAATGCTTGG + Intronic
1031688038 7:124756668-124756690 TTCATGGGAAGTGAAATGACAGG + Intronic
1032837189 7:135685199-135685221 TTGCGGGGAATTGAAATGATAGG + Intronic
1034559032 7:151867925-151867947 TTCCAGGGGAGTTCATTGCTGGG - Intronic
1036096164 8:5726560-5726582 TTACAGGGAAATGAATTGCAAGG + Intergenic
1036188236 8:6644311-6644333 TTCTAAAGAAATGAAATGCTAGG + Intergenic
1036801767 8:11797801-11797823 TTCCAGGCAGGTGAATTGCTTGG + Intronic
1036823165 8:11955756-11955778 TGCCAGGGAAGGGAAGGGCTGGG + Intergenic
1037306077 8:17505104-17505126 TTACAGGGAAGTGAACTGGATGG - Intronic
1037574218 8:20185579-20185601 TTCCAAGGAAGTGAAATTACTGG - Intergenic
1037606460 8:20441814-20441836 TTCCAGGCAAGAGAGATTCTGGG + Intergenic
1038634717 8:29276388-29276410 TTCCAGACAAATGAAAGGCTTGG + Intergenic
1038940135 8:32295625-32295647 CTCCAGGGAAGTCAAGTGATTGG + Intronic
1039195249 8:35023874-35023896 TTCCAGGCAAGTGGAATTCAAGG - Intergenic
1039339617 8:36633086-36633108 TTCCAAGGAAATCAAATGCCAGG - Intergenic
1039826964 8:41182922-41182944 TTCCAGGGAAAGGAAATGTTGGG - Intergenic
1040031626 8:42830096-42830118 TTCCAGGGAAGTTAAAGGATTGG - Intergenic
1045079764 8:98612875-98612897 TTCCAGAGGGGTGAAATTCTTGG - Intronic
1045762435 8:105626423-105626445 TTCCAGGGTGGAGAACTGCTTGG + Intronic
1046338584 8:112823169-112823191 TTCCAGGGAGTTGAAATGGAGGG - Intronic
1047918571 8:129608918-129608940 TTCCAGAGACTTTAAATGCTTGG + Intergenic
1050342552 9:4654945-4654967 GACCAGGGAAGGGAAGTGCTCGG - Intronic
1052336423 9:27324606-27324628 TTCCAGGGGAGTGAATGGTTTGG + Intergenic
1052395750 9:27935865-27935887 TTCCAGAGAACAAAAATGCTGGG - Intergenic
1052668750 9:31528318-31528340 TTCCAGGCCAGTGAAATTCATGG - Intergenic
1055544477 9:77354738-77354760 TTTCAGTGAAGTGGAATGCAAGG - Intronic
1056820722 9:89840133-89840155 TTCTCGGGAAGTGTAATCCTGGG + Intergenic
1057163377 9:92907217-92907239 TTCCAGGGAACAGAAATTTTGGG - Intergenic
1057492477 9:95532085-95532107 TGCCAGGGTAGTGAATAGCTAGG + Intergenic
1058065422 9:100543609-100543631 GCCCAGGGAAGTCAAATGATTGG - Intronic
1058667833 9:107336783-107336805 TTCCAGGGCAGTGAGAAACTTGG + Intergenic
1059521772 9:114949362-114949384 TTCCAGGGAAGCCAAAAGATTGG + Intergenic
1203663497 Un_KI270754v1:4405-4427 GTCCAGTGAAATTAAATGCTTGG + Intergenic
1187616023 X:20994359-20994381 TTCCAGGAAAGTTAACTCCTTGG - Intergenic
1188070724 X:25715186-25715208 TTCCAGGAAAGGGAAGTGATAGG - Intergenic
1189226218 X:39415354-39415376 TGGGAGGAAAGTGAAATGCTGGG + Intergenic
1189275262 X:39780807-39780829 TTCTAGGGAAGAGAAATGCTGGG - Intergenic
1189323962 X:40102083-40102105 TTCCAGATGAGTGAAATCCTGGG - Intronic
1189744475 X:44156076-44156098 TTCCTTGGAAGTGCAATGCAGGG + Intronic
1190390865 X:49930332-49930354 TTCCAAGAAAATGAATTGCTGGG - Intronic
1190512325 X:51185821-51185843 GTCCAGAGATGAGAAATGCTGGG - Intergenic
1190639150 X:52466212-52466234 TTACAGGGAAGTGACATGTATGG + Intergenic
1190649626 X:52556345-52556367 TTACAGGGAAGTGACATGTATGG - Intergenic
1192464962 X:71348229-71348251 CTCCTGGGAAGTGAAGTTCTAGG - Intergenic
1193114001 X:77758037-77758059 TACCAGGGAAGGGGAATGCAAGG - Intronic
1193421904 X:81292828-81292850 GTCCAGGGAAGCCAAATGATTGG - Intronic
1193897240 X:87128752-87128774 TTCCAGGGGAGTGAATTGTTCGG - Intergenic
1194115898 X:89897945-89897967 TACCAGTGAAGTCAAATGTTTGG - Intergenic
1197655042 X:129107656-129107678 TTCCTTGGAAGTATAATGCTGGG - Intergenic
1198394946 X:136211571-136211593 TTTCAGGGATGTGAAAATCTGGG - Intergenic
1200468700 Y:3555074-3555096 TACCAGTGAAGTCAAATGTTTGG - Intergenic