ID: 1118931661

View in Genome Browser
Species Human (GRCh38)
Location 14:70247541-70247563
Sequence CAGGGAAGTGAAATGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931649_1118931661 12 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349
1118931653_1118931661 10 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349
1118931647_1118931661 26 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349
1118931654_1118931661 -1 Left 1118931654 14:70247519-70247541 CCTTCAAGGGGATCACCACTTCC No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349
1118931651_1118931661 11 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG 0: 1
1: 1
2: 1
3: 31
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931661 Original CRISPR CAGGGAAGTGAAATGCTGGG AGG Intergenic
901861921 1:12079823-12079845 CAAGGACACGAAATGCTGGGAGG - Intronic
902230073 1:15022196-15022218 CAGGGCAGGGAAGTGATGGGAGG - Intronic
902466742 1:16623334-16623356 CCAGGAAGGGAAATGCTGGTGGG - Intergenic
902503634 1:16926014-16926036 CAGGGAAGGGAAGAGGTGGGAGG + Intronic
902507868 1:16949439-16949461 CCAGGAAGGGAAATGCTGGTGGG + Intronic
902721346 1:18306382-18306404 CAGGGGTGGGAAATTCTGGGTGG - Intronic
903739973 1:25553038-25553060 CAGGGAAGGGTAAGGGTGGGTGG - Intronic
904042361 1:27592288-27592310 CAGGCAGGTGACAAGCTGGGTGG - Intronic
905099588 1:35507471-35507493 CAGGGAAGTGGCAAGTTGGGAGG + Intronic
906341605 1:44985954-44985976 CAGGGCAGTGAAATATAGGGAGG - Intronic
906377129 1:45304477-45304499 GTGGGAAGTGAAAGGCCGGGGGG + Intronic
906651014 1:47512883-47512905 AAGGGGACTGAAATGGTGGGAGG + Intergenic
906875422 1:49533130-49533152 AAGGGAAGTGAAGCACTGGGTGG - Intronic
908155650 1:61350042-61350064 CATGGAGGTGAAAGGGTGGGGGG - Intronic
908810174 1:67974132-67974154 CAGGGAAGGGACTTGGTGGGAGG + Intergenic
909607620 1:77522587-77522609 CAGGGAGGTGGGATGGTGGGAGG - Intronic
910555135 1:88523213-88523235 CAGGGATGAGGAATGCTTGGGGG - Intergenic
911426271 1:97717590-97717612 GGGGGAAGAGAAATGGTGGGTGG - Intronic
912436013 1:109661483-109661505 CAGGGAAGGGTAGTGTTGGGAGG - Exonic
912437952 1:109675064-109675086 CAGGGAAGGGTAATGATGGGAGG - Exonic
912440463 1:109693523-109693545 CAGGGAAGGGTAATGATGGGAGG - Exonic
912795229 1:112689270-112689292 CAGGGAACTGGTCTGCTGGGAGG + Intronic
913282353 1:117198478-117198500 CAGGGAATGGAAATGTTGGATGG - Intronic
915730728 1:158052304-158052326 CAGGTAAGGGGAATGTTGGGTGG - Intronic
917554189 1:176067227-176067249 AGGGGCAGTGAAGTGCTGGGAGG + Intronic
917656913 1:177135587-177135609 CAGCAAAGTGAAAAGCTGGGGGG + Intronic
917960655 1:180141731-180141753 CAGGGAAGGGGAATGCTAAGTGG - Intergenic
918954392 1:191186821-191186843 CAAGGAAGGGACATGGTGGGAGG + Intergenic
919275139 1:195404329-195404351 AAAGGAAATGAAATGGTGGGAGG - Intergenic
920398033 1:205660617-205660639 CAGGGAGGAGAAGTCCTGGGAGG - Intronic
922041957 1:221905338-221905360 CAGGGAAGTGGAAGCTTGGGGGG - Intergenic
922069971 1:222182556-222182578 CATGGGAGGGAAATGGTGGGAGG + Intergenic
924658792 1:245997497-245997519 CAAGGAAGTGAAATCATGTGAGG - Intronic
1062991304 10:1821835-1821857 CATGGAAGGGACATGGTGGGAGG - Intergenic
1063467074 10:6253743-6253765 CAGGAAGGTGATATGCTGGCTGG + Intergenic
1063480920 10:6375663-6375685 CAGGAAAATGATTTGCTGGGGGG - Intergenic
1064263974 10:13809623-13809645 CAGGGAACTGGAATGCAGGTGGG - Intronic
1065018010 10:21479211-21479233 GAGGGAAGTGAAGTTTTGGGAGG - Intergenic
1066248358 10:33607247-33607269 CAGGGGAGGGAACTGTTGGGAGG - Intergenic
1068460612 10:57323591-57323613 CAGAGAAGTGAATTCCAGGGAGG - Intergenic
1069652235 10:70057891-70057913 CAGGAAAACGAAATGGTGGGGGG + Intronic
1070509756 10:77149908-77149930 CAGTGAAGTCATATGCTGCGAGG - Intronic
1071791832 10:88963108-88963130 CATGGAAGTGACCTGGTGGGAGG - Intronic
1072640026 10:97204945-97204967 CAGGGAAGCGCAATGCTGGTGGG + Intronic
1072772907 10:98157503-98157525 ACTGGAAGTGAAATGCCGGGAGG - Intronic
1073206262 10:101770951-101770973 CAGGGAACCGAAGTCCTGGGGGG - Intronic
1073322916 10:102626456-102626478 CAGCAACGTGGAATGCTGGGAGG + Intronic
1073976870 10:109112083-109112105 CAGGGGAGGGAACTGGTGGGAGG + Intergenic
1074121199 10:110495756-110495778 TGAGGAAGTGAGATGCTGGGAGG - Intergenic
1074134198 10:110612878-110612900 AAGAGAAATGAAATGCTTGGGGG - Intergenic
1075167285 10:120080064-120080086 CAGGGAAGGGACCTGGTGGGAGG - Intergenic
1075342892 10:121661515-121661537 CAGGGCAGGAAGATGCTGGGAGG + Intergenic
1075985438 10:126781023-126781045 CAGGGAACTGAAATGTCAGGAGG - Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076776646 10:132701593-132701615 CAGGGCCGGGAAGTGCTGGGAGG - Intronic
1078517929 11:12040542-12040564 TAGGGAAGGGAAATGTGGGGTGG - Intergenic
1078590754 11:12638773-12638795 CAGAGAAGGGTAATTCTGGGGGG - Intergenic
1079632905 11:22699337-22699359 CAGGGAAGAGAAATGCCTTGTGG + Intronic
1080270463 11:30446068-30446090 CAAGTGAGTGAAATACTGGGTGG - Intronic
1083330463 11:61896044-61896066 CAGAGAACTGAAATGCCTGGAGG - Intergenic
1084883871 11:72190758-72190780 CAGGAAAGAGAGCTGCTGGGTGG + Intronic
1085230441 11:74964048-74964070 CAGGGTAGAGAAATACGGGGAGG - Intronic
1086184943 11:84002375-84002397 TAGGGAAGGGAAATGTCGGGTGG - Intronic
1086309967 11:85524086-85524108 AAGGGTAGTGAAGTGTTGGGAGG + Intronic
1086345410 11:85891064-85891086 CAGGGGAGAGAAATGTGGGGAGG - Intronic
1087250421 11:95892870-95892892 CAGGGAAGTGGATTCCTGTGAGG - Intronic
1088692293 11:112338216-112338238 TAGGGAAGTCAAGTGTTGGGGGG + Intergenic
1089212981 11:116819077-116819099 AAAGGAAGTGAGATGCAGGGTGG - Intergenic
1090081218 11:123614123-123614145 CAAGGATGTGAATGGCTGGGTGG - Intronic
1090127308 11:124100684-124100706 TAGGGCAGAGAAATGCTGCGGGG + Intergenic
1091649263 12:2297524-2297546 AAGGGAAGAGAGATGCTAGGGGG + Intronic
1091795945 12:3297623-3297645 CAGGGCAGTCACAGGCTGGGTGG - Intergenic
1091915481 12:4269735-4269757 GAGGGGAGTGAGATGCTAGGTGG + Intergenic
1092137629 12:6160779-6160801 CACCCAAGTGAAATGCTGAGGGG + Intergenic
1092597538 12:10023760-10023782 CAGGGAAGAGAAATCATGGAGGG + Intergenic
1094416098 12:30216464-30216486 CAGAAAAATGAAATGTTGGGTGG - Intergenic
1095502600 12:42856741-42856763 TAGGGAAGTGTAATGCTGAATGG + Intergenic
1095756088 12:45768698-45768720 CAGGGAAATGAAGAGCTGGGAGG + Intronic
1097334832 12:58370441-58370463 CAGGGACATGAAATGCTGTCTGG + Intergenic
1099345264 12:81491910-81491932 CAGGCAAGAGAAATGATGTGAGG - Intronic
1100098743 12:91076561-91076583 GAGGGAAGGGAAGTGCAGGGAGG + Intergenic
1100674460 12:96850911-96850933 CAAGGAAGGGAACTGGTGGGAGG - Intronic
1100909912 12:99347290-99347312 CTGGGAAGTGAGATGCTTGGGGG + Intronic
1101098816 12:101371447-101371469 CAGGTAAGTGAATTGAGGGGTGG + Intronic
1101434647 12:104654484-104654506 CAGTGCAGTGCACTGCTGGGTGG + Intronic
1101455102 12:104824079-104824101 AAGGGAAGGGAAGTGCTGTGTGG + Intronic
1101549897 12:105751963-105751985 CAGAGATGCGAAATTCTGGGAGG + Intergenic
1103283415 12:119779699-119779721 CAGGGAAGAGAGATGTTGGGGGG - Intronic
1104104237 12:125644152-125644174 CTGGGAGGTGAAGTGCTGGTGGG - Exonic
1104550381 12:129751403-129751425 CAGGGGAGGGACATGGTGGGAGG - Intronic
1104859066 12:131915382-131915404 CAGGGAGCTGAGATGCGGGGTGG + Exonic
1105628448 13:22136935-22136957 GAGGGAAGGGAGAAGCTGGGAGG + Intergenic
1107661030 13:42639682-42639704 CAGGCAAGAGAAATGCTATGGGG - Intergenic
1107957674 13:45532491-45532513 GAGGGAAGGGAAAGGCTGGAGGG - Intronic
1108850780 13:54726936-54726958 CATGGAAGGGAACTGGTGGGAGG + Intergenic
1109583793 13:64372805-64372827 CATGGAAGGGACATGGTGGGAGG - Intergenic
1112153967 13:96797201-96797223 AATGGAAGTGAAATGCTGCAGGG + Intronic
1113187505 13:107706139-107706161 CAGGGAAAGGCAAAGCTGGGTGG + Intronic
1113952317 13:114078949-114078971 CAGGGAGGAGCAGTGCTGGGTGG - Intronic
1116638753 14:47433637-47433659 CAGGGAAATGAAGTGTTGTGGGG + Intronic
1118011599 14:61615633-61615655 AAGGAAAGTGAAATGATGGTGGG - Intronic
1118762634 14:68890091-68890113 TAGGGAAGTGAAGCCCTGGGGGG + Intronic
1118931661 14:70247541-70247563 CAGGGAAGTGAAATGCTGGGAGG + Intergenic
1118953502 14:70457597-70457619 CGGGGAAGTGAAATGCTGGGAGG - Exonic
1118960382 14:70524638-70524660 TGGAGAAGTGAAATACTGGGAGG + Exonic
1119995488 14:79248885-79248907 CAGGGGAGGGAAATGCAGGTGGG + Intronic
1120361753 14:83513473-83513495 CAGGGAGCTGAAATGCCAGGAGG + Intergenic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1123110920 14:105866515-105866537 CAGGCAAGGCAAAGGCTGGGAGG + Intergenic
1202873094 14_GL000225v1_random:182164-182186 AAGGGAACTGAAAATCTGGGAGG + Intergenic
1123991133 15:25684153-25684175 CAGGAAAGTGAGATTCAGGGAGG + Intronic
1124973147 15:34509973-34509995 CAGGGAGGTGGAAAGATGGGAGG - Intergenic
1125077607 15:35637795-35637817 TAGGCAAGTGAAGTGCTGTGAGG + Intergenic
1128734612 15:70046127-70046149 CAGAGAAGTGAAATGATGTCTGG - Intergenic
1128971217 15:72108498-72108520 CAGGGAAGAGAAATGTGGGAAGG + Intronic
1130063225 15:80584347-80584369 CAAGGAAGTGGAGTGCTGGCTGG + Intronic
1130274421 15:82469097-82469119 CAGGGAAGGTGAATGCAGGGAGG + Intergenic
1130337679 15:82971228-82971250 CAGGTAAGTAAAATTATGGGGGG + Intronic
1130447846 15:84020733-84020755 CAGGGAAGGGAAAGGCTGTTTGG + Intronic
1130466768 15:84196471-84196493 CAGGGAAGGTGAATGCAGGGAGG + Intergenic
1130497496 15:84477065-84477087 CAGGGAAGGTGAATGCAGGGAGG - Intergenic
1130589063 15:85201064-85201086 CAGGGAAGGTGAATGCAGGGAGG + Intergenic
1131248242 15:90814397-90814419 AAGGAAAGTGAGATGCTGGAAGG + Intronic
1132014853 15:98306441-98306463 CACGGAATTGGAATTCTGGGGGG - Intergenic
1133329096 16:4960183-4960205 CAGGGAAGTGAAGTGCTCAGAGG - Intronic
1135859196 16:26039723-26039745 AAGGGTAGTGAAAGGGTGGGGGG - Intronic
1136254313 16:29028227-29028249 CATGGAAATGAGATGCTGGATGG + Intergenic
1137778522 16:51077045-51077067 CAGGGAAGGGGAGTGGTGGGAGG - Intergenic
1139589940 16:67927986-67928008 AAGGGAACTGCAGTGCTGGGTGG + Exonic
1140732764 16:77871431-77871453 CAGGGATGAGAAAAGCTGGGGGG - Intronic
1140827477 16:78720615-78720637 CAAGAATGTGAAATGCTGGCAGG - Intronic
1141403633 16:83772752-83772774 CAGGGAAGTGAGGTGAGGGGTGG - Intronic
1142574495 17:897489-897511 AAGGGAAGGAAAATGCCGGGCGG + Intronic
1143251220 17:5524665-5524687 GAGGGAGCTGAAATCCTGGGAGG + Intronic
1143290817 17:5826664-5826686 CAGGGAAGTGAATTCCTCAGTGG + Intronic
1143438478 17:6949135-6949157 CAGGCAAAGGAAATGATGGGAGG + Intronic
1143987262 17:10925751-10925773 GAGAGAAGTGAGATGATGGGAGG + Intergenic
1144497087 17:15754819-15754841 CTGGGAAGTGGCATGGTGGGGGG - Intergenic
1146133118 17:30295319-30295341 CATGGGTGTGAATTGCTGGGTGG - Intergenic
1146587091 17:34091582-34091604 CAGGGAAGGGAGATGATGGATGG + Intronic
1147977287 17:44255130-44255152 TAGGGAAGGGGCATGCTGGGGGG + Intronic
1148813551 17:50310622-50310644 GAGAGGAGTGAAAGGCTGGGAGG - Intergenic
1149003834 17:51783986-51784008 CAGGGAAGTGGAGTGCAGCGGGG + Intronic
1150563127 17:66312321-66312343 CAGGAGAGTGAAATACTCGGAGG - Intronic
1150944334 17:69728475-69728497 GAGGGGAGTGACATGGTGGGTGG + Intergenic
1151226983 17:72655079-72655101 CAGGGCATTGCATTGCTGGGCGG + Intronic
1151790948 17:76305524-76305546 AAGGGAAGTGAGATGCAGTGGGG + Intronic
1152248845 17:79200966-79200988 GAGGGCAGTGAAGGGCTGGGAGG - Intronic
1152405809 17:80097169-80097191 CAGGGAAGAGTCAGGCTGGGAGG - Intronic
1154010173 18:10567576-10567598 CAGAAAAGTGAAATGCAGAGGGG - Intergenic
1154412313 18:14148116-14148138 CTGGTGAGTGACATGCTGGGTGG - Intergenic
1154492097 18:14930329-14930351 CAGGGCAGTGAGTTTCTGGGAGG + Intergenic
1158851758 18:61501806-61501828 CAGGGAGGAAAAATGCAGGGAGG + Intronic
1160128829 18:76205632-76205654 GAGGAAACTGAAATGCCGGGAGG + Intergenic
1160365623 18:78323772-78323794 CAGGGAAGGGAAATGGTGATGGG + Intergenic
1160402178 18:78619140-78619162 TGGGGAAGTGAAAAGCTGAGTGG - Intergenic
1162401717 19:10450722-10450744 CAGGTGAGTGGACTGCTGGGTGG - Intronic
1163728025 19:18933363-18933385 CAGGGAAGGGAACAGCAGGGAGG - Intronic
1164557450 19:29264715-29264737 CAGGGAAGTGCAACGGTGGGTGG + Intergenic
1165912418 19:39237381-39237403 TAGGGAAGTTAACTGGTGGGAGG + Intergenic
1166125140 19:40710669-40710691 CAGGGCTGAGAACTGCTGGGAGG - Intronic
925219641 2:2127785-2127807 CAGGGAAATGTGATTCTGGGAGG - Intronic
926412608 2:12620230-12620252 CTGGGAAGTGAAGTCCTGGTGGG - Intergenic
926447765 2:12965201-12965223 CAGAGAAGTGAAGGGCTGGGAGG - Intergenic
926630669 2:15133331-15133353 CAGGGAAGTGAAATGAAGAAAGG + Intergenic
927840723 2:26441564-26441586 CAAAGAAGTGAAATACTGGAGGG + Intronic
929055706 2:37874523-37874545 CTGGGCAGTGACAAGCTGGGGGG + Intergenic
929628440 2:43434312-43434334 GAGGGCAGGGAAGTGCTGGGAGG + Intronic
931458471 2:62431080-62431102 CAAGGAAGTGGAATGATGGATGG + Intergenic
933723054 2:85410353-85410375 GAGGGAAGTGAGAAGCCGGGTGG - Exonic
934675402 2:96246345-96246367 CAGGAAAGTGAGGAGCTGGGAGG + Intergenic
935385363 2:102493575-102493597 TAGGGGAGTGACATGGTGGGAGG - Intronic
936108828 2:109648438-109648460 GAGGCAAGAGAACTGCTGGGAGG - Intergenic
936554575 2:113483704-113483726 CAGGCAAAAGAAATGTTGGGAGG - Intronic
936639332 2:114294649-114294671 CAGGGAAGTGGCTTGCTGGGAGG - Intergenic
936696011 2:114949313-114949335 CAGGGGAGGGACCTGCTGGGAGG - Intronic
937299986 2:120833145-120833167 CAGGGAAAGGAAATGCAGGAGGG - Intronic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938576816 2:132612060-132612082 CAGGGCACTGCAATGCTGGATGG - Intronic
938939471 2:136156627-136156649 CAGGGAACTAAAATGCTGATTGG - Intergenic
940677193 2:156738827-156738849 CAGGGAAATGAGCAGCTGGGTGG + Intergenic
942251537 2:174051549-174051571 CAGGGAATTGAAGCCCTGGGAGG + Intergenic
944048674 2:195440973-195440995 CTGGGAATGGAAATGCTAGGTGG - Intergenic
944676423 2:202036430-202036452 TAGGGAAAAGAACTGCTGGGTGG + Exonic
945336493 2:208599116-208599138 CAAGGAAGGGACATGGTGGGAGG - Intronic
946155501 2:217804299-217804321 GAGGGAAGTGAATTGCAGAGGGG - Exonic
947684635 2:232072104-232072126 CAGGAAAGGGAAATGCTTTGAGG + Intronic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
947873755 2:233454675-233454697 CAAGGAAGAGAAATGCTGAGAGG + Intronic
1168944343 20:1739180-1739202 AAGGGAAGAGAAATGATGGGAGG + Intergenic
1169556840 20:6760236-6760258 CAGGAAAGAGAAAGGCTGGGAGG + Intergenic
1170232870 20:14069737-14069759 CAGGGAAGTGACATTCTTTGGGG - Intronic
1170886403 20:20343435-20343457 GAGGGAAGTGGAGGGCTGGGTGG + Intronic
1170934761 20:20800113-20800135 CAGGGAAGTGAGATCCAGGAGGG + Intergenic
1172186607 20:33034960-33034982 TCAGGAAGTGATATGCTGGGGGG - Intronic
1172207622 20:33175528-33175550 AAGGAAAGTGAGATGCTGGTTGG - Exonic
1172765641 20:37349312-37349334 GTGGGAAGTGCAATGCTGGGTGG + Intronic
1174112453 20:48205848-48205870 AAGGGAAGGGAAATACTTGGTGG - Intergenic
1174168783 20:48603671-48603693 AAGGGAAGGGAAATACTTGGCGG + Intergenic
1174181813 20:48679814-48679836 CAGTGAAGGCCAATGCTGGGGGG - Intronic
1174775528 20:53339884-53339906 CTGGGAAGTGAGATGCTGCCTGG - Intronic
1175597227 20:60244834-60244856 AAGGGAGGTGAAAGGGTGGGAGG - Intergenic
1176425802 21:6547579-6547601 CAGGGAGGTGGGCTGCTGGGGGG - Intergenic
1177264391 21:18764658-18764680 GAGGGCAGAGAAGTGCTGGGAGG + Intergenic
1178212964 21:30558954-30558976 CAGGGTAGGGAACTGGTGGGAGG + Intronic
1178446403 21:32647522-32647544 GAGAGAACTGAAAAGCTGGGAGG - Intronic
1178888413 21:36500199-36500221 CAAGGAAGTGAAACATTGGGAGG + Intronic
1178980214 21:37257661-37257683 CAGGGTTGTGAAAAGCTGGAAGG - Intronic
1179115404 21:38486992-38487014 CAGGGAAGTGAAAGGCGTGGTGG + Intronic
1179701293 21:43155896-43155918 CAGGGAGGTGGGCTGCTGGGGGG - Intergenic
1179716011 21:43288938-43288960 GAGGGAGGTGAAATGATGGGAGG + Intergenic
1181458983 22:23075191-23075213 AAGGGAGGAGAAATGCTGTGGGG - Intronic
1181939920 22:26467639-26467661 CAGGCATGTAAAATGCTGGTAGG - Intronic
1183258622 22:36779515-36779537 AGGGGAAGGCAAATGCTGGGTGG + Intergenic
1184178719 22:42805103-42805125 CAGGGGAGTGAGTTTCTGGGTGG + Intronic
1184319806 22:43732241-43732263 CAGGGAAATGGAGAGCTGGGTGG + Intronic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184987757 22:48146914-48146936 CATGCAGGTGAATTGCTGGGAGG - Intergenic
1185052339 22:48560351-48560373 CCGAGAATGGAAATGCTGGGGGG - Intronic
949349020 3:3105316-3105338 CAGGGAAGAGACATGCCTGGTGG + Intronic
949739527 3:7214707-7214729 AAGGGAAGGAAAATGCTGGCAGG + Intronic
950184688 3:10937868-10937890 CTGGGGTGTGAATTGCTGGGTGG - Intronic
951127456 3:19000738-19000760 CAGGGAAGTGCAATACAGGGAGG + Intergenic
951626833 3:24674528-24674550 CTGGGAAGTGTAGTGGTGGGTGG + Intergenic
952513307 3:34078551-34078573 GAGGAAAGGGAAATGCTGCGTGG + Intergenic
952944939 3:38472914-38472936 CTGGGAGGTCAAATACTGGGAGG - Intronic
953810996 3:46112811-46112833 CAGGGATGTGAATGCCTGGGTGG - Intergenic
954707144 3:52487157-52487179 CAGGTCAGTGGCATGCTGGGAGG - Intronic
955041274 3:55320075-55320097 CAGGGAAATGAAGTTCTGAGAGG + Intergenic
956036831 3:65102460-65102482 CAGGGAAGGGACCTGATGGGAGG + Intergenic
957222812 3:77406268-77406290 CAAGGAAGGGACATGCTGGGAGG - Intronic
958754385 3:98233513-98233535 CAGGGAAGGGACCTGATGGGAGG + Intergenic
960261367 3:115572353-115572375 CAGGAAAGGGAAATGCAGAGTGG + Intergenic
960326259 3:116299840-116299862 CAGGGAACTGAAAGGCTGTGGGG + Intronic
962095195 3:132285587-132285609 TAGGGCAGGGAAGTGCTGGGCGG - Intergenic
962191625 3:133316923-133316945 CAGGGAAGTCAAACTGTGGGTGG + Intronic
964346460 3:155759109-155759131 CAGGAAAATGAAGTGCTGGCAGG - Intergenic
966610113 3:181859778-181859800 CAGGAAGGTGAAAGGCTTGGAGG - Intergenic
966856531 3:184197746-184197768 CAGGGAATTGACATACTGGATGG + Intronic
967254789 3:187578962-187578984 CAGTGAAGTAAAAAGCTGTGGGG + Intergenic
967937021 3:194737158-194737180 GAGGGAAGAGAAAGGCAGGGTGG - Intergenic
968182830 3:196609894-196609916 AAGGGAAGGGAAAAGCTGGTTGG + Intergenic
968220518 3:196935112-196935134 AAGGGAAGGGAAATTGTGGGTGG - Intergenic
968793233 4:2683764-2683786 CTGGTAAGTGGAATGCTGGAAGG - Intronic
968870389 4:3239110-3239132 CAGGGAAGTAAAATGCTGACAGG + Intronic
969487675 4:7481374-7481396 CAGGGAAGGAAAGAGCTGGGTGG + Intronic
969912557 4:10459232-10459254 CAGGGAGATGAAATGCTTTGTGG + Intergenic
970686759 4:18577453-18577475 CAAGGAAGTTAGATGGTGGGAGG - Intergenic
972473845 4:39432350-39432372 CAAGCAAGTCAAATGCTGAGGGG + Intronic
973827352 4:54721664-54721686 CAGGGAGGTGAGGTGCTGAGAGG + Intronic
975037132 4:69697964-69697986 CATGGAAGGGACATGGTGGGAGG - Intergenic
977256816 4:94749948-94749970 CAGGCAGGAGAAATGGTGGGAGG + Intergenic
977533238 4:98225036-98225058 CAGGGAAGTGCAGTGGTGGTGGG - Intergenic
977638215 4:99325108-99325130 GAGGGAACTGAAATGCTTGCTGG + Intergenic
981503251 4:145474675-145474697 CAGGGGAGTGACCTGGTGGGAGG - Intergenic
981725469 4:147842830-147842852 CAAGGAAGGGAAAAGGTGGGTGG - Intronic
984780502 4:183521667-183521689 CACGAAAGTGAAAAGCTGGTTGG - Intergenic
984967016 4:185148520-185148542 AAGGGAAATGAAATGGGGGGAGG + Exonic
985521630 5:376442-376464 CAGGGCTGTGGAATGCTGCGTGG + Intronic
986165348 5:5267843-5267865 CGGGGCAGGGAAGTGCTGGGAGG - Intronic
986884761 5:12219805-12219827 CAGGGAAGGGTAATGGTGGGGGG - Intergenic
987682296 5:21153293-21153315 CAGATGAGTGAAATTCTGGGAGG - Intergenic
988099142 5:26656112-26656134 CTGGGAAGAGAACTGGTGGGAGG - Intergenic
991109352 5:62880703-62880725 AAGGAAAGTGAGATGTTGGGAGG + Intergenic
991407409 5:66314306-66314328 CAGGGAGTTGAGCTGCTGGGTGG + Intergenic
992863819 5:80938463-80938485 CAGGGGAGTGACCTGGTGGGAGG + Intergenic
994214114 5:97117860-97117882 CAGAGTAGTGAGATGCGGGGTGG - Intronic
994805405 5:104441006-104441028 CAAAGAAGTAAAATGGTGGGAGG - Intergenic
998358779 5:141566093-141566115 AAGGACAGTGAAATGCTGGTAGG + Intronic
999429078 5:151510684-151510706 TATTGAAGGGAAATGCTGGGAGG + Intronic
1002913087 6:1506023-1506045 CAGGCAAGAGAAGAGCTGGGTGG - Intergenic
1003646248 6:7915103-7915125 CTGAGAAGGGGAATGCTGGGAGG - Intronic
1003832906 6:10034414-10034436 CAGGAAACTGAAGTGCTGTGAGG - Intronic
1004088441 6:12474361-12474383 CAGAGAAGGGGCATGCTGGGTGG + Intergenic
1004397447 6:15258279-15258301 CAGGGATGTGAAACAATGGGAGG + Intronic
1006077387 6:31542469-31542491 CAGGGAACTGGATTGCTCGGGGG + Intronic
1006440125 6:34048665-34048687 CAGGGAAGGGACTTGGTGGGAGG + Intronic
1007419534 6:41711497-41711519 CAGGGAAGAGAGATGCTGGAAGG - Intronic
1007484838 6:42173834-42173856 CAGGGAGGGGAAGTGCTGGAGGG + Intronic
1007682361 6:43643353-43643375 CAGGGAAAGGAAAGGCTGAGAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008727738 6:54442108-54442130 CAGGGCAGGGAGGTGCTGGGAGG - Intergenic
1009038744 6:58151639-58151661 CTGGGAAGGGAATTCCTGGGTGG - Intergenic
1009214635 6:60906496-60906518 CTGGGAAGGGAATTCCTGGGTGG - Intergenic
1009820679 6:68797233-68797255 CTGGGCAGTGAACTGCTAGGGGG - Intronic
1012072359 6:94639557-94639579 CAGGTCAGGGAAGTGCTGGGAGG + Intergenic
1012370697 6:98503181-98503203 CAGGGGAGTGAAATGCCAGTTGG - Intergenic
1013300708 6:108802720-108802742 GAGGGAAAGGGAATGCTGGGTGG + Intergenic
1013533955 6:111046617-111046639 CAGGGAAGGGTAATGTTGGGAGG + Intergenic
1014223915 6:118826273-118826295 CAGGGAGGTGCACTGCTAGGAGG - Exonic
1014568008 6:122974818-122974840 CAGGGATGTGAGATGGAGGGAGG + Intergenic
1015036070 6:128656075-128656097 CAGGGAAATGAAATGTTTTGTGG + Intergenic
1015324431 6:131908377-131908399 CAGGGTTCTGAAAAGCTGGGGGG + Intergenic
1015745594 6:136506399-136506421 AAGGGAAGAGAAATGTGGGGAGG + Intronic
1015931673 6:138366870-138366892 CAGGGAAGGGAAATGGGGTGGGG + Intergenic
1018807312 6:167271256-167271278 GAGGGAATTGCAATTCTGGGCGG + Intronic
1018984223 6:168623702-168623724 CAGGAAGGTGAGATGCTGGGCGG + Intronic
1019272641 7:159020-159042 CAGGGAGGTGCAGTGCTGCGGGG + Intergenic
1020835118 7:13139599-13139621 CAGGGAAGTGCAAGATTGGGTGG + Intergenic
1021009330 7:15442627-15442649 GAGGGCAGGGAAGTGCTGGGAGG + Intronic
1021019189 7:15575419-15575441 GAGTGAAGTGAAAGGGTGGGAGG - Intergenic
1023003967 7:35842495-35842517 CAGGGAAGGGGAATGCTGAATGG + Intronic
1023364521 7:39450522-39450544 GAGGGAAGGGAAATGCTTGCAGG - Intronic
1023921592 7:44634229-44634251 CAGGGAAAAGAAAGGCTGTGGGG + Intronic
1024264401 7:47595744-47595766 CGGGGAAGAGAAGTGCTGGGAGG + Intergenic
1024978028 7:55131660-55131682 CAGTGAATTGAATTGCTGGGGGG - Intronic
1024984197 7:55181484-55181506 CAGGGAAGGGAGATACGGGGAGG + Intronic
1026405883 7:70065055-70065077 CAGAGATGTGAAGTGGTGGGGGG + Intronic
1027681867 7:81232504-81232526 CAGGGCTGTGACATGCTGTGGGG - Intergenic
1027911104 7:84252134-84252156 CAGGGAAGAGGATTGCTGGGAGG - Intronic
1028452264 7:90998942-90998964 CTGGGAAGTGCAAGGCTGAGGGG + Intronic
1029539187 7:101172941-101172963 CAGGGACGTGAAAGCCAGGGAGG + Intronic
1030919990 7:115371364-115371386 CATTGAAATGAAATGCTGGTGGG - Intergenic
1031016119 7:116578447-116578469 CAGGGAGTAGAAATGCTGTGGGG - Intergenic
1033105433 7:138516994-138517016 CTGGGAGGTGAGATGGTGGGAGG + Intronic
1034000013 7:147401642-147401664 CAGGGAAGGGGACTGGTGGGAGG + Intronic
1034840049 7:154387310-154387332 CAGGGAACTGAAAGACTAGGAGG + Intronic
1034985115 7:155507690-155507712 AAGTGAAGTGAAATGTTGGATGG - Intronic
1036096165 8:5726563-5726585 CAGGGAAATGAATTGCAAGGAGG + Intergenic
1037069152 8:14621770-14621792 CAGGGGAGAGAACTGGTGGGAGG - Intronic
1040585654 8:48738566-48738588 CAAGGAAGAGAATGGCTGGGTGG - Intergenic
1040782089 8:51121600-51121622 CGGGGCAGGGAAATGCTGGGAGG + Intergenic
1043205069 8:77427138-77427160 CAGGGAAGGGAGCTGTTGGGAGG + Intergenic
1043483375 8:80675074-80675096 CAAGGAAGTGAAATTCTAGTAGG + Intronic
1044504296 8:93000513-93000535 CATGGGAGGGAAATGGTGGGAGG - Intronic
1045412601 8:101933636-101933658 CAGGGAAGAGCAAAGTTGGGTGG - Intronic
1047493042 8:125390024-125390046 CAGGCAAGTAAAATGCTGGGGGG + Intergenic
1048042271 8:130742857-130742879 CAGGGATGTGACAAGCTGGGTGG - Intergenic
1048043467 8:130752348-130752370 CACGGAAGGGACATGGTGGGAGG - Intergenic
1048257882 8:132919152-132919174 CCGGGAAGTGACATGCTTGTAGG - Intronic
1048343222 8:133556424-133556446 CAGAGGAGTGAGATGCTGGCAGG + Intronic
1048671787 8:136730651-136730673 AAGGGCAGGGAAGTGCTGGGAGG - Intergenic
1049580395 8:143408157-143408179 CCGGGAAGGGAAAGGGTGGGCGG - Intergenic
1049829611 8:144692124-144692146 CAGGGAAGCCAAAGGCTGTGGGG - Intergenic
1049898435 9:133481-133503 CAGGCAAAAGAAATGTTGGGAGG + Intronic
1051241365 9:15060140-15060162 CAGAGAAGGGAAATGTAGGGAGG - Intergenic
1052552164 9:29966113-29966135 CAGGGAAGGGACCTGGTGGGAGG - Intergenic
1052780925 9:32781887-32781909 CAGTGAAGTGAGATGAAGGGAGG - Intergenic
1053741495 9:41143783-41143805 CAGGCAAAAGAAATGTTGGGAGG + Intronic
1054346709 9:63973266-63973288 CAGGCAAAAGAAATGTTGGGAGG + Intergenic
1054444486 9:65299926-65299948 CAGGCAAAAGAAATGTTGGGAGG + Intergenic
1054485786 9:65721572-65721594 CAGGCAAAAGAAATGTTGGGAGG - Intronic
1054686851 9:68287518-68287540 CAGGCAAAAGAAATGTTGGGAGG - Intronic
1056573326 9:87834942-87834964 GGGGGCAGGGAAATGCTGGGAGG - Intergenic
1056763422 9:89430150-89430172 CAGGGAAGGGAATTACTGGACGG + Intronic
1057284800 9:93743376-93743398 AAGGGGAGTGAACTGATGGGAGG - Intergenic
1057991563 9:99776061-99776083 CTGGGTAGTGAGATGCTGGTGGG - Intergenic
1058307873 9:103465251-103465273 CATGGAAGTGGCATGGTGGGAGG - Intergenic
1059282554 9:113147519-113147541 CAGGGAAGGTAAGTGCTGTGAGG - Intergenic
1061068426 9:128293827-128293849 CAGGCAAGGCAAAAGCTGGGCGG - Intergenic
1061305595 9:129731133-129731155 CAGGGAGGTGGGATTCTGGGTGG + Intergenic
1062374892 9:136257630-136257652 GATGGAGGTGCAATGCTGGGGGG - Intergenic
1203731362 Un_GL000216v2:94373-94395 AAGGGAACTGAAAATCTGGGAGG - Intergenic
1186568450 X:10689441-10689463 CAGGGGAGGGAACTGATGGGAGG - Intronic
1188225368 X:27591352-27591374 CAGGGAATTGAAAATGTGGGAGG - Intronic
1188578134 X:31678356-31678378 CAGGGAAGTAACATGGTAGGAGG - Intronic
1188942269 X:36254675-36254697 TGGGGAAGTGAGATGCTGGAGGG + Intronic
1189084350 X:38004777-38004799 AAGGGTAGTGAGGTGCTGGGGGG + Intronic
1189166216 X:38863619-38863641 AAGGGGAGTGAAAAGCTGGTAGG + Intergenic
1189323960 X:40102080-40102102 CAGATGAGTGAAATCCTGGGAGG - Intronic
1189552961 X:42112777-42112799 CAAGGGAGAGAACTGCTGGGAGG - Intergenic
1189642356 X:43086303-43086325 CAGGGCAGGGACGTGCTGGGAGG - Intergenic
1191762688 X:64662401-64662423 CTGGGAAGTGCAAAGCAGGGTGG - Intergenic
1191829283 X:65398445-65398467 CAGGGAAGGGACCTGGTGGGAGG + Intronic
1193113999 X:77758034-77758056 CAGGGAAGGGGAATGCAAGGAGG - Intronic
1193760911 X:85463661-85463683 CATGGGAGTGACATGGTGGGAGG + Intergenic
1193908451 X:87271688-87271710 CTGGGAAGGGAAGTGCAGGGAGG + Intergenic
1194316252 X:92380310-92380332 AAGGCAAGTCAAATGCAGGGAGG - Intronic
1194443035 X:93955772-93955794 CATGGAAGAGAACTGGTGGGAGG + Intergenic
1194686211 X:96920518-96920540 CAGGGAATTGAATTGGTGGAAGG + Intronic
1195675793 X:107506621-107506643 CTGGGAAGGGATAGGCTGGGAGG - Intergenic
1195738257 X:108035563-108035585 CAGGGGAGAGGAATTCTGGGAGG - Intergenic
1196281446 X:113828124-113828146 CGGGGCAGGGAAGTGCTGGGTGG + Intergenic
1196612948 X:117734662-117734684 CAGGGAATGGGAATCCTGGGTGG - Intergenic
1197034151 X:121854184-121854206 CAGCAAAGTGATATGGTGGGTGG - Intergenic
1197107077 X:122729473-122729495 CAGGGAAGGGACCTGGTGGGAGG - Intergenic
1197643019 X:128986938-128986960 CATGGAAGGGACATGGTGGGAGG + Intergenic
1200010199 X:153114711-153114733 AAGGGGAGGGGAATGCTGGGGGG - Intergenic
1200029401 X:153285211-153285233 AAGGGGAGGGGAATGCTGGGGGG + Intergenic
1200624296 Y:5491883-5491905 AAGGCAAGTCAAATGCAGGGAGG - Intronic
1200731710 Y:6749690-6749712 AAGGGAACTCAAAGGCTGGGGGG + Intergenic
1201356643 Y:13103966-13103988 AAGGGAACTCAAAGGCTGGGGGG - Intergenic