ID: 1118931662

View in Genome Browser
Species Human (GRCh38)
Location 14:70247542-70247564
Sequence AGGGAAGTGAAATGCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 1, 2: 4, 3: 78, 4: 640}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118931654_1118931662 0 Left 1118931654 14:70247519-70247541 CCTTCAAGGGGATCACCACTTCC No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640
1118931653_1118931662 11 Left 1118931653 14:70247508-70247530 CCTGCTGATCACCTTCAAGGGGA No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640
1118931647_1118931662 27 Left 1118931647 14:70247492-70247514 CCTTTGCACTTCTGCCCCTGCTG No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640
1118931649_1118931662 13 Left 1118931649 14:70247506-70247528 CCCCTGCTGATCACCTTCAAGGG No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640
1118931651_1118931662 12 Left 1118931651 14:70247507-70247529 CCCTGCTGATCACCTTCAAGGGG No data
Right 1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG 0: 1
1: 1
2: 4
3: 78
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118931662 Original CRISPR AGGGAAGTGAAATGCTGGGA GGG Intergenic
900757787 1:4449199-4449221 AGGGAAGTGAGTTACTGTGAAGG - Intergenic
902230072 1:15022195-15022217 AGGGCAGGGAAGTGATGGGAGGG - Intronic
902905960 1:19557728-19557750 AGGGAAGGGAAGTGAAGGGAAGG - Intergenic
903039349 1:20516814-20516836 AGGGAAATGAAATGCAGGGTAGG + Intergenic
903756659 1:25666859-25666881 AGGGAAGAGGAATTCTGTGAAGG + Intronic
904015408 1:27416243-27416265 GGGGCATTGAAATGCTGGTATGG - Intronic
905702839 1:40031596-40031618 AGGGAAAGGAAAAGCTGGGGAGG - Intergenic
905741496 1:40374661-40374683 AGGGAAGTGAGATGGCGGAAAGG + Intronic
906377130 1:45304478-45304500 TGGGAAGTGAAAGGCCGGGGGGG + Intronic
906931461 1:50173928-50173950 AGAGAAATGCTATGCTGGGAGGG - Intronic
907277154 1:53323121-53323143 AGGGAAATGAAGGCCTGGGAAGG + Intronic
907961591 1:59288499-59288521 AGGGAAGTGAAATTCAGGAAAGG - Intergenic
909767236 1:79371995-79372017 AGGGAAGTGAAGGGAAGGGAAGG - Intergenic
909767238 1:79372000-79372022 AGGGAAGGGAAGTGAAGGGAAGG - Intergenic
909862930 1:80632294-80632316 GGAGAAGGGAAGTGCTGGGAAGG + Intergenic
910440891 1:87250665-87250687 AAGGAAGACAAATGCTTGGAAGG + Intergenic
910549867 1:88463326-88463348 AGGGAAGGGAATTGGTGGGGTGG - Intergenic
911426270 1:97717589-97717611 GGGGAAGAGAAATGGTGGGTGGG - Intronic
911587127 1:99704415-99704437 ACGGGAGGGAAGTGCTGGGAAGG + Intergenic
911742521 1:101402558-101402580 AAGGAACTGAAATGCTAAGAAGG + Intergenic
912152973 1:106882022-106882044 AGGGAAGTGATATGGTGCTATGG + Intergenic
912436012 1:109661482-109661504 AGGGAAGGGTAGTGTTGGGAGGG - Exonic
912437951 1:109675063-109675085 AGGGAAGGGTAATGATGGGAGGG - Exonic
912440462 1:109693522-109693544 AGGGAAGGGTAATGATGGGAGGG - Exonic
912795230 1:112689271-112689293 AGGGAACTGGTCTGCTGGGAGGG + Intronic
913246157 1:116871668-116871690 AGGGAGGGGAGATGGTGGGAGGG + Intergenic
915099406 1:153488139-153488161 TGGGAATTCAATTGCTGGGAAGG + Intergenic
915876087 1:159613383-159613405 AGGGAAATGAAAAGATGGGGTGG - Intergenic
916401516 1:164453836-164453858 AGGGAAGGGAAGGGCAGGGAAGG + Intergenic
916893951 1:169141843-169141865 AATGAAGTGAATAGCTGGGATGG + Intronic
917050538 1:170917492-170917514 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
917726606 1:177833783-177833805 AGGGAAGGGAAGGGGTGGGAGGG - Intergenic
918115420 1:181491983-181492005 AGGGCAGTGGATGGCTGGGAGGG + Intronic
918312540 1:183295426-183295448 AGGGAGGTAAAAAGGTGGGAGGG - Intronic
918519829 1:185403758-185403780 GGGGAAGGGAAGTGCTGGCAAGG + Intergenic
919138395 1:193539248-193539270 ATGGAAGTTAAATGTTGGTAAGG - Intergenic
919539201 1:198827922-198827944 ACTGAAGGGAAGTGCTGGGAAGG - Intergenic
919741874 1:200985805-200985827 AGGGAAGGGAAAGGAAGGGAGGG - Intronic
920548517 1:206838725-206838747 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
920897909 1:210075792-210075814 AGGGCAGGGAAGTGCTGGGAAGG - Intronic
923210489 1:231799847-231799869 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
923678228 1:236098428-236098450 AGGGAAGGGAAAAGAAGGGAAGG + Intergenic
923784083 1:237051178-237051200 AGGGAAGGGAAAAGGAGGGAAGG - Intronic
923867803 1:237959137-237959159 AGGGAAAAGAAGTCCTGGGAAGG - Intergenic
924804647 1:247352697-247352719 AAGGCAGAGAAATTCTGGGAGGG + Intergenic
1062933194 10:1366144-1366166 AGGGAAGTGCAATGAGGGGCTGG + Intronic
1063679471 10:8173200-8173222 AGGCAAGTGGAAGCCTGGGATGG - Intergenic
1063711686 10:8484977-8484999 AGGGAACTGAAATGTCAGGATGG + Intergenic
1064160369 10:12940302-12940324 TGGGAAGTGAGATGTTGGCATGG + Intronic
1064283738 10:13973680-13973702 AGGGAAGAGAAGTGAGGGGAGGG + Intronic
1064462310 10:15546839-15546861 AGGGAAGGGAAATGAGGGGAAGG + Intronic
1064462314 10:15546854-15546876 GGGGAAGGGAAATGAAGGGAAGG + Intronic
1064875756 10:19992744-19992766 AAGGAAATGAAATGCTGTTAAGG - Intronic
1064990408 10:21251935-21251957 AGGGAAGTGGAGAGCTGAGAAGG - Intergenic
1065018009 10:21479210-21479232 AGGGAAGTGAAGTTTTGGGAGGG - Intergenic
1065169175 10:23010415-23010437 AGGGAAGGGAAGGGGTGGGAGGG - Intronic
1065178759 10:23104461-23104483 ATGGAAGTGAAATGACAGGAAGG - Intronic
1065452653 10:25874578-25874600 AGGGAAGGGAAGGGATGGGAAGG + Intergenic
1065775009 10:29111455-29111477 AGGGAAGTGAAAAGCTAGTTTGG + Intergenic
1066569369 10:36754336-36754358 AGGGAAGGGAAGGGCCGGGAAGG + Intergenic
1067076058 10:43183261-43183283 ATGGAAGTGAAAGGTTGGGGTGG + Exonic
1067511234 10:46896459-46896481 AGGGAGGTTAAATTCTGGGCAGG + Intergenic
1067651018 10:48155403-48155425 AGGGAGGTTAAATTCTGGGCAGG - Intergenic
1067742664 10:48907685-48907707 AAGGAGGAGAAATGCTAGGAAGG - Intronic
1068015919 10:51516179-51516201 AGGGAGCTGGAATGCTGGAATGG + Intronic
1069420854 10:68245126-68245148 AGAGAAGGGAAATGGTGGCAGGG + Intergenic
1069913882 10:71775438-71775460 AAGGAAGTGAAAAGGGGGGAGGG - Intronic
1070058829 10:72961443-72961465 AGGCAATAGAAATGCTGGCAAGG - Intergenic
1070472416 10:76795937-76795959 AGGGAAATCAAAGGTTGGGAAGG + Intergenic
1070498670 10:77049450-77049472 AGAGAAGTCAAATGCTGTGATGG - Intronic
1070727475 10:78802263-78802285 AGGGGAGGGTGATGCTGGGATGG + Intergenic
1070739820 10:78895450-78895472 AGGGAAGGGAAAAGAAGGGAAGG + Intergenic
1071074242 10:81732422-81732444 ATGGAAGGGAAGTTCTGGGAAGG + Intergenic
1072580925 10:96739746-96739768 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1072772906 10:98157502-98157524 CTGGAAGTGAAATGCCGGGAGGG - Intronic
1073057045 10:100709714-100709736 AGGGAACTGGAAGGCTGGGGTGG - Intergenic
1073289757 10:102407750-102407772 AGGGAAGGAAAGTGCTGAGAGGG - Intronic
1073704762 10:105970695-105970717 AAGGAATTGGAATGATGGGAAGG - Intergenic
1073763316 10:106654658-106654680 TGGTAAGTGAGATGCTTGGAGGG - Intronic
1074121198 10:110495755-110495777 GAGGAAGTGAGATGCTGGGAGGG - Intergenic
1075685700 10:124363941-124363963 ATGGAAGGGGCATGCTGGGAAGG - Intergenic
1076165654 10:128280513-128280535 AGAGAAGTGAGAAGGTGGGAGGG - Intergenic
1076434578 10:130431326-130431348 GTGAAAGTGAAATGCTGGAATGG - Intergenic
1076852521 10:133100020-133100042 ACGGAAGTGTAGTGCTGGGAAGG - Intronic
1077168856 11:1157564-1157586 AGGAAAGGGAAAGGCTGGGCTGG + Intergenic
1078373018 11:10766730-10766752 AGTGGAGTGAAAGGATGGGATGG - Intronic
1078517928 11:12040541-12040563 AGGGAAGGGAAATGTGGGGTGGG - Intergenic
1078843014 11:15096644-15096666 AGGGAAAGGAAAAGTTGGGAAGG - Intergenic
1079273595 11:19012686-19012708 AGGAATGTGAAATGCTAGGCTGG - Intergenic
1080410036 11:32014598-32014620 AGAGAAGAGAAAGGGTGGGATGG + Intronic
1080887947 11:36383654-36383676 AGGAAAGCCTAATGCTGGGATGG - Intronic
1080940712 11:36914545-36914567 AGAGAAGGGACATTCTGGGAAGG - Intergenic
1081473209 11:43396791-43396813 AGAGAAGTGAAGTGCTCGCATGG - Exonic
1081678998 11:44988707-44988729 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1082739078 11:56890422-56890444 AAAGAAGTGAGAAGCTGGGAAGG + Intergenic
1082770406 11:57203415-57203437 AGGGGGGTGAAAGGCAGGGAAGG - Intergenic
1083022558 11:59521722-59521744 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1083098419 11:60277709-60277731 AAGGAAGTGTTATGGTGGGAAGG + Intergenic
1084007959 11:66333199-66333221 AGGAAGGTGAAAGGCGGGGATGG + Intronic
1084111415 11:67016320-67016342 AGGGAAGTGGGCTGCTGAGAAGG + Intronic
1084627262 11:70318017-70318039 AGGGAGCTGAAAGGCTGGCAGGG - Intronic
1085018295 11:73189548-73189570 AGGGAAGGGAAATGCAAGCAGGG + Intergenic
1085547364 11:77332356-77332378 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1085547377 11:77332391-77332413 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1085680213 11:78566432-78566454 AGGTAAGTGGAATGGTAGGACGG + Intronic
1086184942 11:84002374-84002396 AGGGAAGGGAAATGTCGGGTGGG - Intronic
1086309968 11:85524087-85524109 AGGGTAGTGAAGTGTTGGGAGGG + Intronic
1086395785 11:86413514-86413536 ACAGAAGGGAAGTGCTGGGAAGG - Intronic
1086518838 11:87646275-87646297 AGGGAAGTGAAGGGTAGGGAAGG - Intergenic
1086518850 11:87646307-87646329 AGGGAAGCGAAGTGTAGGGAAGG - Intergenic
1087461501 11:98453832-98453854 GAGGAAGGGAATTGCTGGGAAGG - Intergenic
1087462026 11:98457184-98457206 GGGGAAGGGAAGCGCTGGGAAGG - Intergenic
1087767994 11:102177170-102177192 AGGGATGTGAAATGATGTGGAGG + Intronic
1087816402 11:102663850-102663872 GGGGAAGGGAAGTGCTGGGAAGG + Intergenic
1087821654 11:102719212-102719234 TAGGAAGTGAGATCCTGGGAAGG - Intronic
1088432353 11:109772889-109772911 AGGGAAGTGTGAGGATGGGAGGG - Intergenic
1088800751 11:113305184-113305206 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1089122033 11:116144385-116144407 GGGGAAGGGAAGTGCTGGGAAGG + Intergenic
1089212980 11:116819076-116819098 AAGGAAGTGAGATGCAGGGTGGG - Intergenic
1089416610 11:118297397-118297419 AGGGTAGTGAAAGACTGGGGTGG - Intergenic
1089938058 11:122385818-122385840 AGAGATATGAAATGCCGGGAGGG - Intergenic
1090135980 11:124199569-124199591 ATGGAAGGAAAGTGCTGGGAAGG - Intergenic
1090854703 11:130601428-130601450 AGTGAAATCAAATGCTGTGATGG + Intergenic
1091406163 12:210831-210853 AGGGCAGTGACCTGCTGAGAGGG - Intronic
1091915482 12:4269736-4269758 AGGGGAGTGAGATGCTAGGTGGG + Intergenic
1092671022 12:10860788-10860810 AGGGAAGGGAAAGGGAGGGAAGG + Intronic
1093000032 12:13985997-13986019 GGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1093656054 12:21695122-21695144 GGGGAAGGGAAGTGCTGGGAAGG - Intronic
1093680191 12:21993583-21993605 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1093922712 12:24877541-24877563 AGGAAATTGAAGAGCTGGGATGG - Intronic
1094025496 12:25957246-25957268 AGTGGAGTGAAAGGCTGAGAAGG + Intergenic
1095234169 12:39777404-39777426 ACAGAAGGGAAGTGCTGGGAAGG + Intronic
1095376228 12:41531647-41531669 GGGGAAGGGAAGTGCTGGGGAGG - Intronic
1095866667 12:46979706-46979728 AGGGAAGGGAAAGGAAGGGAGGG + Intergenic
1096171577 12:49475937-49475959 CGGGAAGGGAAGTGCTGGGAAGG + Intronic
1096199684 12:49672735-49672757 GGGGAAGGGAAATGCCGGTAGGG + Intronic
1096414511 12:51401796-51401818 GGGGCAGGGAAGTGCTGGGAAGG - Intronic
1096656279 12:53094471-53094493 AGGGAAGTGTAATCCTGGGGTGG + Intergenic
1096744476 12:53716419-53716441 AGGGAAGTGGAAAGCAGGTAAGG + Intronic
1096846777 12:54411809-54411831 AGGCCAGTGAAATTCAGGGAGGG - Intronic
1097193908 12:57233431-57233453 ATGGAAGGGAAATGCCAGGATGG + Intronic
1098802422 12:74978410-74978432 AGGGAAGTGAAGGGAAGGGAAGG + Intergenic
1099958353 12:89373120-89373142 AGGGGACTGAAGTTCTGGGAGGG - Intergenic
1100256283 12:92886506-92886528 AGGGAAGAGAAAGGAAGGGATGG + Intronic
1100396349 12:94189335-94189357 AGGGATGTGAAAAGGTGGCAGGG + Intronic
1100523302 12:95397311-95397333 AGGGAAGGGAAATGGTGAGAAGG + Intergenic
1100777239 12:97988402-97988424 AGGGAAGGGAAACGAAGGGAAGG + Intergenic
1100777266 12:97988502-97988524 AGGAAAGGGAAATGAAGGGAAGG + Intergenic
1100777295 12:97988597-97988619 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777302 12:97988617-97988639 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777307 12:97988632-97988654 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777312 12:97988647-97988669 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777317 12:97988662-97988684 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777407 12:97988974-97988996 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777429 12:97989039-97989061 AGGGAAGGGAAGTGAAGGGAAGG + Intergenic
1100777431 12:97989044-97989066 AGGGAAGTGAAGGGAAGGGAAGG + Intergenic
1100777435 12:97989059-97989081 AGGGAAGGGAAATGAAGGGAAGG + Intergenic
1100777468 12:97989175-97989197 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777475 12:97989195-97989217 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777480 12:97989210-97989232 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777485 12:97989225-97989247 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777490 12:97989240-97989262 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777511 12:97989304-97989326 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777522 12:97989334-97989356 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1100777557 12:97989469-97989491 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1101812012 12:108115512-108115534 AGGGAAGTGAAAAAGAGGGAGGG - Intergenic
1102745215 12:115243907-115243929 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1103249250 12:119485943-119485965 AAGGAAGTGAATTGGTGAGATGG - Intronic
1103952235 12:124557600-124557622 AGGGACGTGAATGGGTGGGAAGG + Intronic
1104923340 12:132302730-132302752 AGGGAAGAGAAAGGCCAGGAGGG + Intronic
1105379114 13:19870477-19870499 AGGGAAGGGAAAGGAGGGGAAGG - Intergenic
1105614516 13:22000093-22000115 ATGGAAGGGAAGTGCTGGGAAGG + Intergenic
1105673506 13:22644914-22644936 ATGGAAGGGAAGTGCTGGGAAGG - Intergenic
1105682723 13:22745455-22745477 ATGGAAGGGAAGTGCTGGGAAGG - Intergenic
1106016124 13:25870466-25870488 ATGGAAGGGAAGTGCTGGGAAGG - Intronic
1106235521 13:27857404-27857426 TGGGAAAGGAAGTGCTGGGAAGG - Intergenic
1106319367 13:28623947-28623969 ACCGAAGGGAAGTGCTGGGAAGG + Intergenic
1106585265 13:31051737-31051759 AGGAATTTGAAAAGCTGGGATGG - Intergenic
1107820040 13:44277532-44277554 AGGGAAGTGAAGGGGAGGGAAGG + Intergenic
1107957673 13:45532490-45532512 AGGGAAGGGAAAGGCTGGAGGGG - Intronic
1108040028 13:46331285-46331307 AGGGAATTTAGATGCTAGGAAGG + Intergenic
1108215206 13:48176983-48177005 GAGGAACTGAAAAGCTGGGAGGG + Intergenic
1108887762 13:55209432-55209454 AGGGAAGAGAATTGCTTGGGCGG - Intergenic
1108974705 13:56424334-56424356 TGGGAAGTGAAACCCTGGAAAGG + Intergenic
1109152517 13:58861322-58861344 GGGGAAGGGAAACGCTGGGTAGG - Intergenic
1109331022 13:60929807-60929829 AGGAAAGTAAAAGGCTGGGAAGG + Intergenic
1109552175 13:63917850-63917872 AGGGAAGGGAAAAGAAGGGAGGG - Intergenic
1109559522 13:64029198-64029220 ATGGAAGGGAAGTGTTGGGAAGG + Intergenic
1109651382 13:65331160-65331182 ATGGAAGGGAATTGCTGGAAAGG - Intergenic
1110756906 13:79185547-79185569 AGGGAAAAGAACTGGTGGGATGG - Intergenic
1111048317 13:82846416-82846438 AGGGAAGGGAAAGGAAGGGAGGG + Intergenic
1111931499 13:94517495-94517517 AGGGAAGTGGAAGGATGTGAGGG - Intergenic
1111976215 13:94968784-94968806 GGGAACGTGAAATGCTGAGATGG - Intergenic
1112171999 13:96983399-96983421 AGGGAAGGGAAACGAAGGGAAGG + Intergenic
1112941324 13:104866139-104866161 CGGGCAGGGAAGTGCTGGGAAGG + Intergenic
1113142502 13:107169883-107169905 AGGGAAAGGAAAGGCCGGGAAGG + Exonic
1113698086 13:112362913-112362935 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1113881037 13:113626487-113626509 AGGGAAGTGGGACGCGGGGAAGG - Intronic
1114682577 14:24498848-24498870 AGGGAATTGGAATGGAGGGAGGG + Intergenic
1114924972 14:27384465-27384487 GGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1115389928 14:32842785-32842807 GGGGAAGGGAAATGAAGGGAAGG + Intergenic
1115407980 14:33040355-33040377 AGAGAACTGAAGTGCTGGGTAGG + Intronic
1116137273 14:40943180-40943202 AGGGAAGTGAAGTGAAGTGAAGG - Intergenic
1116937985 14:50761761-50761783 AGAGAAGTGGATTGGTGGGAAGG + Intronic
1118011598 14:61615632-61615654 AGGAAAGTGAAATGATGGTGGGG - Intronic
1118931662 14:70247542-70247564 AGGGAAGTGAAATGCTGGGAGGG + Intergenic
1118953501 14:70457596-70457618 GGGGAAGTGAAATGCTGGGAGGG - Exonic
1118960383 14:70524639-70524661 GGAGAAGTGAAATACTGGGAGGG + Exonic
1119673728 14:76538895-76538917 AGGGAAGGGAAAGGAAGGGAGGG - Intergenic
1119809229 14:77502172-77502194 AGGAAATTGGAATGGTGGGAAGG - Intergenic
1120583813 14:86287040-86287062 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1120717561 14:87855960-87855982 AGGGAAGGGAAGGGCAGGGAAGG + Intronic
1120744608 14:88142428-88142450 ACGGAAGGGAAGTGCTGGGAAGG + Intergenic
1121165361 14:91791165-91791187 AGGGAAGGGAAAGGAGGGGAGGG + Intronic
1121289153 14:92760444-92760466 AGGGAAAGGAAATGAAGGGAGGG - Intergenic
1121876884 14:97460946-97460968 TGGTAACTGAAATCCTGGGATGG + Intergenic
1122161843 14:99790818-99790840 AGGGAAAGGAAATGGGGGGAGGG - Intronic
1124151606 15:27184167-27184189 AGGGAAGGCAAATTATGGGAAGG + Intronic
1124973146 15:34509972-34509994 AGGGAGGTGGAAAGATGGGAGGG - Intergenic
1125077608 15:35637796-35637818 AGGCAAGTGAAGTGCTGTGAGGG + Intergenic
1125579104 15:40773334-40773356 AGAAAACTGAAGTGCTGGGAAGG + Intronic
1125684551 15:41556132-41556154 AAGGAAGTAAAAGGCTGGGTTGG + Intergenic
1126757464 15:51938590-51938612 AAAGAAGTGAAATGCTGAGGAGG - Intronic
1127837104 15:62798743-62798765 AGGGAAGTGTCATGCCGTGAGGG - Intronic
1128613324 15:69090747-69090769 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1128705037 15:69832346-69832368 AGGGAAGGGAAATGAAGGAAGGG + Intergenic
1128705042 15:69832365-69832387 AGGGAAGGGAAATGAAGGAAGGG + Intergenic
1128705047 15:69832384-69832406 AGGGAAGGGAAATGAAGGAAGGG + Intergenic
1128705052 15:69832403-69832425 AGGGAAGGGAAATGAAGGAAGGG + Intergenic
1128705057 15:69832422-69832444 AGGGAAGGGAAATGAAGGAAGGG + Intergenic
1129465837 15:75723795-75723817 AGGGAAGGGAAATGGAGAGATGG - Intergenic
1130003984 15:80076794-80076816 AGTGAAGTGGAATGATGTGAGGG - Intronic
1130819776 15:87482415-87482437 AGGGTAGTGAGGGGCTGGGATGG + Intergenic
1131348668 15:91676362-91676384 ATGGAAGGGAAATCCTAGGATGG + Intergenic
1131727447 15:95242615-95242637 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1131848620 15:96514359-96514381 AGTGGTGTGAAATGCTGGGTAGG + Intergenic
1132187245 15:99811674-99811696 AGGGAGGTGGAAAGATGGGAGGG + Intergenic
1132325775 15:100968811-100968833 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1132428432 15:101741066-101741088 AGGGAGGTGGAAAGATGGGAGGG - Intronic
1133175170 16:4009060-4009082 AGGGAGGTGAAGTGATGAGATGG - Intronic
1133816305 16:9199991-9200013 AGGGAAGGGAAAGGGAGGGAGGG - Intergenic
1134751356 16:16628122-16628144 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1135164806 16:20129662-20129684 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1135811186 16:25588120-25588142 AGGGAAGGGAAAGGAAGGGAGGG - Intergenic
1137996496 16:53220523-53220545 AAGGAAGTGAAATGCAAGGAAGG - Intronic
1139170810 16:64627682-64627704 GGGGAAGGGAAGTTCTGGGAAGG + Intergenic
1139356893 16:66371915-66371937 AGGGAAGGGAAGGGCGGGGAGGG - Intronic
1139471929 16:67183053-67183075 AGGGAAGCAAAGTGCAGGGAAGG - Intronic
1139679762 16:68552424-68552446 AGGGAGGAGAGCTGCTGGGATGG + Intronic
1139876268 16:70148571-70148593 AGGGAAGTGAAGGGAAGGGAAGG - Intronic
1139876270 16:70148576-70148598 AGGGAAGGGAAGTGAAGGGAAGG - Intronic
1140416273 16:74775794-74775816 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1140426485 16:74865923-74865945 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1140541476 16:75760245-75760267 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1140710015 16:77668973-77668995 AGGGGAGTGGGCTGCTGGGAAGG - Intergenic
1141438546 16:84014657-84014679 GGGGAAGTGAAGTGAAGGGAGGG - Intronic
1143923424 17:10349049-10349071 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1143987263 17:10925752-10925774 AGAGAAGTGAGATGATGGGAGGG + Intergenic
1144160705 17:12554848-12554870 AGTGACTTGAAATGCTGGAAAGG + Intergenic
1144305016 17:13961904-13961926 AGGGAAGTGAAGGGAAGGGAAGG + Intergenic
1145805139 17:27721474-27721496 ATGGAACTGAAATGCAAGGATGG - Intergenic
1146069116 17:29663043-29663065 AGAGAAGTGATATGCTTGTAAGG + Intronic
1147952206 17:44113548-44113570 AGAGAAGTGAATTGCAAGGAGGG - Intronic
1148126280 17:45238806-45238828 ATGGAGGTGAAATGTTGGGCAGG + Intronic
1148147344 17:45374067-45374089 AGAGAGGAGACATGCTGGGAAGG - Intergenic
1148164674 17:45475057-45475079 AGGGAAGAGAGAAGATGGGAAGG + Intronic
1148238948 17:45987492-45987514 GGTGAAGTGAAATACTGAGAAGG - Intronic
1148813550 17:50310621-50310643 AGAGGAGTGAAAGGCTGGGAGGG - Intergenic
1148980586 17:51570999-51571021 AGGGAAGTGAAAAAGTGAGATGG - Intergenic
1150004200 17:61459762-61459784 AGAGAAGTGAAAGGCTGTGATGG - Intronic
1150563126 17:66312320-66312342 AGGAGAGTGAAATACTCGGAGGG - Intronic
1150944335 17:69728476-69728498 AGGGGAGTGACATGGTGGGTGGG + Intergenic
1151422146 17:74005542-74005564 AGAGAAGTGGAAGGCTGGGGAGG + Intergenic
1151537132 17:74745304-74745326 AGGGAACTGAAATACCGGGCCGG + Exonic
1151790949 17:76305525-76305547 AGGGAAGTGAGATGCAGTGGGGG + Intronic
1151936187 17:77263140-77263162 AAGGAAGAGACATGCAGGGAGGG + Intergenic
1151947871 17:77329379-77329401 AGGGCAGTGCAAGGCTGGGCAGG - Intronic
1152248844 17:79200965-79200987 AGGGCAGTGAAGGGCTGGGAGGG - Intronic
1152274988 17:79350909-79350931 AGGGAGGGGAAAAGGTGGGAAGG - Intronic
1152335154 17:79696533-79696555 ACAGAAGGGAAGTGCTGGGAAGG + Intergenic
1153710415 18:7793662-7793684 ATGGAAGGGAAGTGGTGGGAAGG + Intronic
1154027621 18:10723610-10723632 AGAGAGGAGAAATGCTGGAAGGG + Intronic
1155791173 18:29972120-29972142 ATGGAAGGGAGTTGCTGGGAGGG - Intergenic
1156243618 18:35276756-35276778 ATGGAAGGGAAATGTGGGGATGG + Intronic
1156884293 18:42116351-42116373 AGGAAAGAGATATGCTGGGTAGG + Intergenic
1157192099 18:45590227-45590249 AGGGAAGGGACATGCTTTGATGG - Intronic
1157287610 18:46387706-46387728 TTGGAAGTCAAACGCTGGGACGG + Intronic
1157535102 18:48452144-48452166 GGGCCAGGGAAATGCTGGGAAGG - Intergenic
1157586130 18:48802417-48802439 AGGGAAGTGTAAGGCAGGGGTGG + Intronic
1158184906 18:54760435-54760457 AGTGAGGTGAAATGCTATGAAGG + Intronic
1159719751 18:71873612-71873634 AGGGAAGGGAAAGGAAGGGAGGG - Intergenic
1159721755 18:71899433-71899455 ATGGAAGGGAAGTGCTGAGAAGG - Intergenic
1160370261 18:78366308-78366330 AGGGAAGTGAGTTGGTGGAAAGG - Intergenic
1160433119 18:78825975-78825997 AGGGAAGAAAAGTGCAGGGAGGG - Intergenic
1160788681 19:912987-913009 AGGGAAGGGAAAGGAGGGGAGGG + Intronic
1161055282 19:2187938-2187960 AGGGAAGTGAAAAGACAGGAAGG + Intronic
1161095402 19:2387527-2387549 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1161793398 19:6373700-6373722 AGGGGAGACACATGCTGGGATGG + Intronic
1161956580 19:7499347-7499369 AGGGAAGTGAAAGGAGCGGAGGG + Intronic
1163351383 19:16778019-16778041 AGGGAAGGGAAAGGGAGGGAAGG + Intronic
1163469831 19:17489638-17489660 AGGGAATTGAGACCCTGGGATGG + Intronic
1163501262 19:17677799-17677821 AGGGAGATGAAGGGCTGGGATGG - Intronic
1164557451 19:29264716-29264738 AGGGAAGTGCAACGGTGGGTGGG + Intergenic
1166125139 19:40710668-40710690 AGGGCTGAGAACTGCTGGGAGGG - Intronic
1166210806 19:41305603-41305625 GCAGATGTGAAATGCTGGGATGG - Intronic
1166246972 19:41536359-41536381 ACAGAAGAGAAGTGCTGGGAAGG + Intergenic
1166247553 19:41539827-41539849 ATGAAAGTGAAGTGCTGGGATGG + Intergenic
1166685353 19:44793297-44793319 TGTGGAGGGAAATGCTGGGAGGG - Intronic
1166690360 19:44818732-44818754 AGGGGAGTGGAGTCCTGGGAAGG - Exonic
1166772249 19:45290866-45290888 AGGGGAGTGGAATGTTGTGAGGG + Intronic
1167195220 19:48023551-48023573 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1168194319 19:54762321-54762343 AGGCAAAAGAAATGCTGGCAAGG - Intronic
1168196372 19:54777042-54777064 AGGCAAAAGAAATGCTGGCAAGG - Intronic
1168236804 19:55068881-55068903 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
925222156 2:2150835-2150857 AGGGAAGGGAAAAGAAGGGAAGG + Intronic
925299458 2:2800220-2800242 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
925306220 2:2849548-2849570 AGGCAACTGAAATGAGGGGACGG - Intergenic
925839734 2:7980146-7980168 GGGGCAGGGAAGTGCTGGGAAGG + Intergenic
926224524 2:10957577-10957599 AGGGAAGTGGAATTCCGGCAGGG - Intergenic
926434499 2:12824476-12824498 AGGAAACTAAATTGCTGGGATGG - Intergenic
926447764 2:12965200-12965222 AGAGAAGTGAAGGGCTGGGAGGG - Intergenic
926474390 2:13304135-13304157 AGGGAAGAGCAATGCTGAGATGG - Intergenic
927443668 2:23139091-23139113 AGGGAAGTGAGGCTCTGGGAGGG - Intergenic
927569620 2:24146752-24146774 AGGGTCATGAAATGGTGGGATGG - Exonic
927656055 2:24947513-24947535 AGAGCAGTGAGATTCTGGGAAGG + Exonic
927937698 2:27084796-27084818 TGGGGTGTGAAAGGCTGGGATGG + Intronic
928271791 2:29862299-29862321 AGGGAAGTGAAAGAAAGGGAAGG + Intronic
928428560 2:31199421-31199443 AGGGAAGGGCAAGGCTGAGAGGG + Intronic
928687977 2:33768934-33768956 ATGGAAGGGAAATGAAGGGAGGG + Intergenic
928784546 2:34866762-34866784 TGGGTAGTGAAATGTTGGTAGGG + Intergenic
928891016 2:36203067-36203089 AGGGAAAAGAAGTGCTGGTACGG - Intergenic
928969521 2:37013214-37013236 AGGGAAGTGAGATACTGAGCTGG + Intronic
929013456 2:37470960-37470982 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
929013461 2:37470975-37470997 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
929121033 2:38484288-38484310 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
929553803 2:42911256-42911278 TGGGAAGTGAAGAGCAGGGAAGG + Intergenic
930327402 2:49937263-49937285 AGGGTATTTAAGTGCTGGGATGG - Intronic
930406834 2:50969113-50969135 AGAGAAGTGAAAGGCAGGAAGGG - Intronic
931207664 2:60163761-60163783 AGGGCAGCGTAATACTGGGAAGG + Intergenic
931607521 2:64066952-64066974 AAGGGAGTGAAATACGGGGAAGG - Intergenic
932094926 2:68839169-68839191 AGGGAAGTTTAAAGCTGGGTAGG - Intergenic
932854745 2:75221492-75221514 AAGTAAGTGAAAGGATGGGAAGG - Intergenic
933187052 2:79290359-79290381 GGGGCAGGGAAGTGCTGGGAAGG + Intronic
933315155 2:80706513-80706535 ATGGAAGGGAAATGCTGGGAAGG + Intergenic
933564898 2:83938303-83938325 AGGGAAGTTAAATGCAGGGGTGG + Intergenic
933594970 2:84274186-84274208 TGGGTAGTGAGAGGCTGGGATGG - Intergenic
933713145 2:85342443-85342465 AGGGAAGGGTGATGCAGGGAAGG - Exonic
933723053 2:85410352-85410374 AGGGAAGTGAGAAGCCGGGTGGG - Exonic
933785356 2:85836585-85836607 AGGGAATGTAAATGCTGGCAAGG + Intergenic
934675403 2:96246346-96246368 AGGAAAGTGAGGAGCTGGGAGGG + Intergenic
935297879 2:101666170-101666192 CGGGCAGGGAAGTGCTGGGAAGG - Intergenic
935940351 2:108231020-108231042 TGGGAAGAGAACTGCTGGGTTGG + Intergenic
936447453 2:112607218-112607240 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
936865923 2:117076827-117076849 AGGGAAGGGACAGGATGGGATGG - Intergenic
938323014 2:130377722-130377744 AGGGAAGAGAAATTCTGGAGAGG - Intergenic
938792220 2:134686706-134686728 GTGGAAGTGAAAAGCTGTGAAGG + Intronic
939587207 2:144020161-144020183 GGGGAAGGGAAGTGCTGGGTAGG + Intronic
939791577 2:146584709-146584731 ATGGAAGAGACATGCTGGTAAGG + Intergenic
942251538 2:174051550-174051572 AGGGAATTGAAGCCCTGGGAGGG + Intergenic
942535943 2:176963999-176964021 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
943334772 2:186600273-186600295 AGGGAAGTGGAATGAAGAGATGG - Intronic
944001003 2:194837417-194837439 AGGAAAGGGAAAGGGTGGGAGGG + Intergenic
944675524 2:202032553-202032575 AGGAAAGTGACATGTTGAGAAGG - Intergenic
944676424 2:202036431-202036453 AGGGAAAAGAACTGCTGGGTGGG + Exonic
944782995 2:203039360-203039382 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
945242256 2:207686854-207686876 AGGGAAGGGGAAGGGTGGGAAGG + Intergenic
945405405 2:209441681-209441703 GATGAAGTGAAAGGCTGGGAGGG + Intronic
945938158 2:215923575-215923597 AGAGTAGAGAAATGGTGGGAAGG - Intergenic
946133390 2:217625194-217625216 AAGGGGGTGATATGCTGGGAGGG - Intronic
946138507 2:217667946-217667968 AGGGACGAGAAATGTGGGGAGGG + Intronic
946237161 2:218331073-218331095 GGGGCAGTGACATCCTGGGAAGG + Intronic
946558614 2:220887750-220887772 AGGGCAGTGAAATGGGCGGAGGG + Intergenic
947620572 2:231588105-231588127 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
947620577 2:231588120-231588142 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
947684636 2:232072105-232072127 AGGAAAGGGAAATGCTTTGAGGG + Intronic
947956711 2:234198510-234198532 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
948506535 2:238431578-238431600 AGGCATGTGGAAAGCTGGGAAGG - Intronic
948691301 2:239706813-239706835 AGGGAAAAGAAAGGCAGGGAAGG - Intergenic
1168754240 20:305093-305115 CAGGAAGGGAAGTGCTGGGAAGG + Intergenic
1169663291 20:8005454-8005476 TGGGCAGGGAAGTGCTGGGAGGG + Intronic
1169870294 20:10241779-10241801 AGGAAAGTGAAGTGTTAGGAGGG + Intronic
1170243474 20:14195373-14195395 GGGGAAGGGAAGTGCTGGGAAGG + Intronic
1170700033 20:18695510-18695532 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1170700038 20:18695525-18695547 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1170959088 20:21009149-21009171 AGGAAAGTGAAATTCAGAGAGGG - Intergenic
1171025183 20:21623779-21623801 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1171069098 20:22049012-22049034 AGGGAAGAGAAAAGAGGGGAGGG - Intergenic
1171204898 20:23271299-23271321 AGGTAAGGGAAACTCTGGGAAGG - Intergenic
1171517650 20:25750619-25750641 AAGGAAGGGAACTGCTGGAAGGG - Intergenic
1172207621 20:33175527-33175549 AGGAAAGTGAGATGCTGGTTGGG - Exonic
1172689514 20:36780568-36780590 AGGGCACTGAAAGGCTGGGCTGG + Exonic
1172816102 20:37687788-37687810 AGGGAAAAGGAATGCTGGTAAGG - Intergenic
1173169826 20:40715035-40715057 AGGCAAATGAAAGGCTGGCAAGG - Intergenic
1173201640 20:40959428-40959450 AGGGAAGGGAAAGGGAGGGAAGG + Intergenic
1173600107 20:44288748-44288770 AGGAAATAGAAATGTTGGGATGG - Intergenic
1173755062 20:45508616-45508638 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1173759795 20:45549574-45549596 TGGAAAGTGAGATGCTTGGATGG - Intergenic
1174432360 20:50479466-50479488 GGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1174564223 20:51453053-51453075 GGGGAAGGGAGATGCAGGGATGG - Intronic
1174844981 20:53935650-53935672 AGGGAAGGGAAGTGAAGGGAAGG - Intergenic
1175116027 20:56683054-56683076 CTGGAGGTGAAGTGCTGGGAGGG + Intergenic
1176239037 20:64067463-64067485 AGGGAAGGGAAGGGCTGGGCTGG + Intronic
1176359604 21:5983527-5983549 AGCAATGTGAACTGCTGGGAAGG + Intergenic
1177601374 21:23318639-23318661 GTGGAAGGGAAGTGCTGGGAAGG - Intergenic
1177912395 21:27049261-27049283 ATGGAAGGGAAGTGCTGGGAAGG + Intergenic
1177953408 21:27567226-27567248 TGGGTAGTGAATGGCTGGGAAGG + Intergenic
1178495105 21:33079536-33079558 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1178888414 21:36500200-36500222 AAGGAAGTGAAACATTGGGAGGG + Intronic
1178980213 21:37257660-37257682 AGGGTTGTGAAAAGCTGGAAGGG - Intronic
1179115405 21:38486993-38487015 AGGGAAGTGAAAGGCGTGGTGGG + Intronic
1179246466 21:39638067-39638089 GGGGAAGAGAAGTGCTGGCAAGG + Intronic
1179716012 21:43288939-43288961 AGGGAGGTGAAATGATGGGAGGG + Intergenic
1179763914 21:43555023-43555045 AGCAATGTGAACTGCTGGGAAGG - Intronic
1180059747 21:45378766-45378788 AGGAAGGTGAGGTGCTGGGAGGG - Intergenic
1180671573 22:17557761-17557783 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1180797536 22:18613840-18613862 GGGGAGGTGAGATGCAGGGATGG + Intergenic
1180839693 22:18953564-18953586 AGGGAAGGCAAGTGCTGGGAAGG - Intergenic
1180930518 22:19587362-19587384 ATGGAAGGGAAGTGCTGGGAAGG - Intergenic
1181062209 22:20286915-20286937 AGGGAAGGCAAGTGCTGGGAAGG + Intergenic
1181082588 22:20424800-20424822 AGGGAAGGGAAGGGGTGGGACGG + Exonic
1181224180 22:21381422-21381444 GGGGAGGTGAGATGCAGGGATGG - Intergenic
1181254452 22:21553401-21553423 GGGGAGGTGAGATGCAGGGATGG + Intronic
1181939919 22:26467638-26467660 AGGCATGTAAAATGCTGGTAGGG - Intronic
1182024564 22:27107901-27107923 GGGAAAGTGACATGCTGGGTAGG + Intergenic
1182410412 22:30180769-30180791 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1182751366 22:32644603-32644625 AGGAAACTGAACTGCTGGGCAGG + Intronic
1184345446 22:43910023-43910045 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1184467166 22:44675604-44675626 AGGAAACTGAGATGCAGGGAGGG - Intronic
1185031104 22:48443508-48443530 AGGGAAGGGAAGGGATGGGAAGG + Intergenic
1185062803 22:48615837-48615859 AGGGATGTGCAATGCAGAGAGGG - Intronic
949187485 3:1210382-1210404 AGGGAAGTGAAGGGAAGGGAAGG + Intronic
949493303 3:4609583-4609605 CTGGATGGGAAATGCTGGGATGG + Intronic
949736464 3:7177644-7177666 AAGGGAATGAAATGCAGGGAGGG + Intronic
949806339 3:7959517-7959539 AGGGAAGGGAAGTGCTGGGAAGG - Intergenic
950103905 3:10376489-10376511 AGGCAAGAGAAATGCTGTAACGG + Intronic
950324746 3:12095990-12096012 ATGGAAAGGAAGTGCTGGGAAGG - Intronic
952507203 3:34018030-34018052 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
952513308 3:34078552-34078574 AGGAAAGGGAAATGCTGCGTGGG + Intergenic
952692379 3:36225070-36225092 TGGGAGGTGAGATGGTGGGAGGG - Intergenic
954693084 3:52406193-52406215 AGGGAGGAGGAATGCAGGGAGGG + Intronic
954707143 3:52487156-52487178 AGGTCAGTGGCATGCTGGGAGGG - Intronic
954864702 3:53718595-53718617 AGGCATGTGAAATGCTGGGCCGG - Intronic
955041275 3:55320076-55320098 AGGGAAATGAAGTTCTGAGAGGG + Intergenic
955263948 3:57423570-57423592 AGGGAACTGCTATGCTGTGAGGG + Intronic
955462513 3:59199988-59200010 AGGGGAGGGAAATGTGGGGATGG - Intergenic
956052180 3:65260034-65260056 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
956052189 3:65260059-65260081 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
956055997 3:65299724-65299746 ATGGATGTGAAGTTCTGGGAGGG - Intergenic
956530310 3:70211435-70211457 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
956530323 3:70211472-70211494 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
956530360 3:70211573-70211595 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
956778547 3:72586773-72586795 TGGGCAGAGAAGTGCTGGGAAGG + Intergenic
956895892 3:73659437-73659459 AGGGATGGCAAATGCTAGGAGGG - Intergenic
957293815 3:78310878-78310900 AGGGAAGGAAAATGATGGGAAGG + Intergenic
957421984 3:79982396-79982418 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
957577610 3:82029749-82029771 AAGCAAGTGAGAGGCTGGGATGG + Intergenic
959369479 3:105504916-105504938 ATGGAAGGGAAGTGCTGGGTAGG - Intronic
960043431 3:113173328-113173350 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
961533236 3:127553054-127553076 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
961701922 3:128751154-128751176 GTGGAAGGGAAATGTTGGGATGG + Intronic
962027781 3:131566793-131566815 AGGTAAAAGTAATGCTGGGAAGG + Intronic
962047342 3:131774723-131774745 AGGGAAGTGAAAGGCAGCAAAGG - Intronic
962072366 3:132045001-132045023 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
962072373 3:132045021-132045043 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
962501643 3:136000151-136000173 AGGGTTTAGAAATGCTGGGAGGG - Intronic
962635823 3:137330455-137330477 AGGAAAGCGAGATGCTGGGCAGG + Intergenic
963239938 3:142992756-142992778 GGGGCAGGGAAGTGCTGGGAAGG - Intronic
963445069 3:145395346-145395368 AGGGAAAGGAAGTGCTGGGTAGG + Intergenic
963702678 3:148645727-148645749 AGGGAAGGGAAAAGTAGGGAAGG - Intergenic
964341956 3:155717373-155717395 ATGGAAGGGAAATGTGGGGATGG - Intronic
964373072 3:156021774-156021796 AGGGAATGGAAATGTGGGGAAGG + Intergenic
964486488 3:157190500-157190522 AGGGAAGAGTCAAGCTGGGAAGG + Intergenic
965107410 3:164375049-164375071 AGGGAAGAAAAATGGGGGGAGGG + Intergenic
965149808 3:164957404-164957426 AAGGAACTGAAATGCCCGGAAGG - Intergenic
966836171 3:184050938-184050960 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
967044300 3:185722532-185722554 AAGTAAGTGATATGGTGGGAAGG + Intronic
967283527 3:187846065-187846087 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
967364137 3:188666625-188666647 AGGAAAGAGAAATGCTTGCATGG + Intronic
967560267 3:190909621-190909643 TTGGAAGTAAAATGCTGAGAAGG - Intergenic
967937020 3:194737157-194737179 AGGGAAGAGAAAGGCAGGGTGGG - Intergenic
968815575 4:2819974-2819996 AGGGGAGTGATATCCTGGGCTGG + Intronic
968870390 4:3239111-3239133 AGGGAAGTAAAATGCTGACAGGG + Intronic
968926551 4:3551458-3551480 AGGGAAGAGGAATGCTCAGATGG - Intergenic
969232946 4:5844366-5844388 AGGGAAGGGGAATGGAGGGAAGG + Intronic
969511671 4:7621265-7621287 AGGGGTGTGAGATGCCGGGAGGG - Intronic
970475215 4:16415367-16415389 GGGGATGTGAAATTCTGGAAAGG + Intergenic
970674363 4:18431869-18431891 AGGGAAGAGAAAAGCAGGGATGG + Intergenic
971112755 4:23607339-23607361 AGGGATGTGAACTGTAGGGAAGG + Intergenic
971171098 4:24233663-24233685 AAGGAAGAGAAATGTTTGGAAGG - Intergenic
971709046 4:30087827-30087849 AGGAAAGTAAAAAGCTGAGATGG - Intergenic
971831436 4:31701272-31701294 GGGGCAGGGAAGTGCTGGGAAGG + Intergenic
972313052 4:37899266-37899288 AGGGAAAAGAAATTCTGGGAAGG + Intronic
972662340 4:41128708-41128730 ATGGAAGTGACATTCTGGTAAGG + Intronic
973604730 4:52575460-52575482 AGGGAAGGGAAAAGATGGGAAGG + Intergenic
973889476 4:55354727-55354749 AGGAAGGAGGAATGCTGGGATGG - Intronic
973936379 4:55850632-55850654 GGGGCAGGGAAGTGCTGGGAAGG - Intergenic
974628190 4:64450949-64450971 AGGGTTGTGAAATGTTGGAAGGG - Intergenic
975867413 4:78738091-78738113 AGGGAAGGGAAAGGAGGGGAGGG + Intergenic
976581310 4:86740206-86740228 AGGGAAGGGAAATGTGGGGTTGG - Intronic
977656180 4:99523498-99523520 AGGGAAGAGAAATTCTTGAAAGG - Intronic
979730457 4:124018169-124018191 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
980623157 4:135336489-135336511 GGGAAATTGAAATGCTGGAAAGG - Intergenic
980716410 4:136636038-136636060 ATGGAAGTGAAGTGCTGGAAAGG + Intergenic
980812055 4:137895486-137895508 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812064 4:137895511-137895533 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812069 4:137895526-137895548 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812076 4:137895546-137895568 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812081 4:137895561-137895583 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812094 4:137895596-137895618 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812101 4:137895616-137895638 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
980812116 4:137895656-137895678 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
981329760 4:143495031-143495053 AGGGTAGTGGAAGGCTGGGGCGG + Intergenic
981638659 4:146910916-146910938 AAGGCAGTGAGATGCTTGGAGGG + Intronic
982017936 4:151174446-151174468 AGGGAAGGGAAAATATGGGATGG - Intronic
983363193 4:166753930-166753952 AGGTAAGTGAAAAGTTGGAATGG - Intronic
983387071 4:167078376-167078398 AGGGATCTGGAATGTTGGGAAGG + Intronic
984335204 4:178380845-178380867 AGGGATATGAAATTCTGGGTTGG - Intergenic
984725063 4:183012903-183012925 AGAGCAGTGACAGGCTGGGACGG + Intergenic
984776274 4:183483647-183483669 AAGCAAATGAAATGCTGGCAGGG + Intergenic
984911230 4:184676374-184676396 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
984967017 4:185148521-185148543 AGGGAAATGAAATGGGGGGAGGG + Exonic
986516808 5:8573098-8573120 AGGGAAGGAAGAGGCTGGGAGGG - Intergenic
987218473 5:15764675-15764697 AGGAAACTAAAATGCAGGGATGG - Intronic
987257970 5:16176819-16176841 AGGGAATTGCAAAGTTGGGAGGG - Intronic
987953486 5:24706593-24706615 AGTGAGTTGAGATGCTGGGAAGG + Intergenic
988038179 5:25853888-25853910 ATGGAAGGGAAGTGCTGGGAAGG - Intergenic
988662770 5:33291470-33291492 AGAGAAGTGAAATGCTGATGAGG - Intergenic
989069680 5:37497322-37497344 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
989277856 5:39610567-39610589 AGGGAAGGGGAAGGCAGGGAAGG - Intergenic
989277873 5:39610614-39610636 AGGGAAGGGGAAGGCAGGGAGGG - Intergenic
989277895 5:39610670-39610692 AGGGAAGAGGAAGGCAGGGAAGG - Intergenic
989277914 5:39610726-39610748 AGGGAAGGGGAAAGCAGGGAAGG - Intergenic
989277934 5:39610782-39610804 AGGGAAGGGGAAGGCAGGGAAGG - Intergenic
989992619 5:50785957-50785979 GGAGAACTGAATTGCTGGGATGG - Intronic
990976885 5:61568470-61568492 AGGGAAGGGAAAGGAGGGGAAGG - Intergenic
992029095 5:72702857-72702879 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
994152403 5:96462866-96462888 AGGGAAGAGAAAGACAGGGATGG - Intergenic
994338801 5:98601069-98601091 ATGGAAGGGAAATGTGGGGATGG + Intergenic
994385062 5:99121264-99121286 AGGGAAGGGAAATGGAGGGGAGG + Intergenic
996566119 5:124881075-124881097 TGGGCAGGGAAATGCTGGGAAGG - Intergenic
996569199 5:124913510-124913532 ACAGAAGGGAAGTGCTGGGAAGG - Intergenic
996612346 5:125397340-125397362 AAGGTAGAGAAATGCTGGGTAGG + Intergenic
997788708 5:136737674-136737696 AAGGAAGTGAAATTCAGAGAAGG - Intergenic
997952589 5:138253791-138253813 AGGAGTGTGAAATGCTGGAAGGG - Exonic
998490140 5:142539536-142539558 AGGGAAGGGGAAAGCAGGGAGGG - Intergenic
999429079 5:151510685-151510707 ATTGAAGGGAAATGCTGGGAGGG + Intronic
1000185190 5:158851731-158851753 AGGGAAGAGAAAGGAAGGGAAGG + Intronic
1000185199 5:158851771-158851793 AGGGAAGAGAAAGGAAGGGAAGG + Intronic
1001852986 5:174985538-174985560 AGTGAAGAGAAATACTGGTAGGG - Intergenic
1002271269 5:178074147-178074169 ATGGAAGGGAAGTGCTGGGAAGG + Intergenic
1002687862 5:181028353-181028375 ACTGAAGGGAAGTGCTGGGAAGG - Intergenic
1002822657 6:740945-740967 AGTGAATTGAAATCCTGGAAAGG - Intergenic
1002845252 6:939600-939622 AAGGAGGTGAAATGCTTGGGAGG + Intergenic
1003092015 6:3112276-3112298 AGGAAAGTGAACTGTTGGGCCGG + Intronic
1003131095 6:3396131-3396153 ACGGAAGGGAAGTGCTAGGAAGG + Intronic
1003646247 6:7915102-7915124 TGAGAAGGGGAATGCTGGGAGGG - Intronic
1003673495 6:8181453-8181475 AGGGAAGGGAAAAGAAGGGAAGG - Intergenic
1003801871 6:9679054-9679076 AGGGAAGGGAAGTGGAGGGAAGG - Intronic
1003809985 6:9768402-9768424 ATGGAAGAGAAGTGCTGGGACGG - Intronic
1003815288 6:9833405-9833427 AGGGAACAGAAATTCTGAGATGG - Intronic
1003905905 6:10699416-10699438 AGGGGACTGAAATGCAGGGGAGG + Intronic
1004180929 6:13379866-13379888 AGGGAAGTGAAATGAGGGTCAGG + Intronic
1004698211 6:18053990-18054012 AGTGCAGTGACATGTTGGGAAGG + Intergenic
1004898125 6:20168785-20168807 AGGGAAGGGAAAAGGGGGGAGGG + Intronic
1005050167 6:21677023-21677045 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1007398947 6:41592864-41592886 AGAGATGTGAAAGGCTGGGCTGG - Intronic
1007419533 6:41711496-41711518 AGGGAAGAGAGATGCTGGAAGGG - Intronic
1007559753 6:42797300-42797322 TGAGAAGTGGAAGGCTGGGAAGG + Intronic
1008730943 6:54481566-54481588 AGGGAAGGGAAATGCTGGGTAGG - Intergenic
1009761530 6:68012958-68012980 AGGGAAGGGAAAGGAAGGGAGGG + Intergenic
1011801541 6:91021775-91021797 GGGGCAGGGAAGTGCTGGGAAGG + Intergenic
1012083568 6:94792884-94792906 TGGAAAGTGAAATGATGAGAAGG + Intergenic
1013300709 6:108802721-108802743 AGGGAAAGGGAATGCTGGGTGGG + Intergenic
1013533956 6:111046618-111046640 AGGGAAGGGTAATGTTGGGAGGG + Intergenic
1013953791 6:115817410-115817432 AGGGAAGGGTAATGATGGGTTGG + Intergenic
1014447730 6:121547515-121547537 ATGGAAGGGAGATGCTGGGAAGG - Intergenic
1015745595 6:136506400-136506422 AGGGAAGAGAAATGTGGGGAGGG + Intronic
1015993370 6:138971812-138971834 AGGGAAGTGAAAAGTGGGGGTGG - Intronic
1016098286 6:140065169-140065191 AGGGAAGGGAAGGGATGGGAAGG + Intergenic
1017048531 6:150369621-150369643 CTGGAAGTGAAAGCCTGGGATGG + Intronic
1017339378 6:153302492-153302514 TGGGAAGTGAAGTGCTGGGTAGG - Intergenic
1017458424 6:154624390-154624412 AGGGACTTGAAATGCTGACAAGG + Intergenic
1017628437 6:156371609-156371631 AGAGAAGTGAGATGCAGTGAAGG - Intergenic
1018509130 6:164506254-164506276 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1018552072 6:165008988-165009010 AGGGGAGTCATAAGCTGGGAAGG - Intergenic
1018807313 6:167271257-167271279 AGGGAATTGCAATTCTGGGCGGG + Intronic
1019791006 7:3013982-3014004 ATGCAAGAGAAATTCTGGGAAGG + Intronic
1020094092 7:5358367-5358389 AAGGAAGAAAAAAGCTGGGATGG + Intronic
1020595748 7:10205181-10205203 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1020662402 7:10997394-10997416 AGGGATGTGAAATTGAGGGAGGG + Intronic
1020685202 7:11285900-11285922 AGGGAAGGGAAAAGAAGGGAAGG - Intergenic
1021009331 7:15442628-15442650 AGGGCAGGGAAGTGCTGGGAGGG + Intronic
1023608351 7:41949918-41949940 AGGGAGTTGAAGTGCTGGAATGG + Intergenic
1023641293 7:42261860-42261882 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1023641298 7:42261875-42261897 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1024208074 7:47180785-47180807 AAGGAAGTGAGATGCTAGAAGGG + Intergenic
1024360719 7:48464662-48464684 AGGGAAGTAAAATAATTGGATGG + Intronic
1024471328 7:49770861-49770883 AGGGAAGTGAAGGGAAGGGAAGG + Intergenic
1024728544 7:52229069-52229091 AGGGAAGGGGAATGTTGGAAAGG + Intergenic
1024984198 7:55181485-55181507 AGGGAAGGGAGATACGGGGAGGG + Intronic
1025231738 7:57207210-57207232 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1026192921 7:68146025-68146047 TGGGAAGGGAGATGCTGGGGAGG + Intergenic
1026394758 7:69940310-69940332 AGGGAAGAGGAAGGCTGGGAAGG + Intronic
1028166917 7:87548178-87548200 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1028166924 7:87548198-87548220 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1028166931 7:87548218-87548240 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1029584765 7:101463487-101463509 AGGGAAGGGAAAGGAGGGGAGGG - Intronic
1029923141 7:104287531-104287553 AGGGAAGTGAAAAGAAGGGAAGG - Intergenic
1029953524 7:104612728-104612750 AGGGAGGTGGAATGCTGTGAAGG + Intronic
1030097706 7:105915585-105915607 AGGGAAGAGAGATCCTGAGAAGG - Intronic
1030769452 7:113456512-113456534 GAGGAAGAGAAGTGCTGGGAAGG + Intergenic
1030888157 7:114964515-114964537 AGGGAAGGGAAGTGAAGGGAAGG - Intronic
1031179414 7:118394936-118394958 ACAGAAGGGAAGTGCTGGGAAGG - Intergenic
1031214875 7:118877315-118877337 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1031436109 7:121733869-121733891 AAGGGAGTGAAATGGTGGCATGG - Intergenic
1031642463 7:124181220-124181242 ACGGACGGGAAGTGCTGGGAAGG - Intergenic
1032435134 7:131894685-131894707 ATGTAAGAGAAATGATGGGATGG - Intergenic
1032582646 7:133117542-133117564 ATGAAAGTGATAAGCTGGGAAGG - Intergenic
1032833042 7:135648034-135648056 AGGGAAGGAGAATGCAGGGAAGG - Intronic
1033242139 7:139689186-139689208 GGGGAAATGAACTGCTGGTAGGG + Intronic
1033509197 7:142038041-142038063 AGGGTAGTGAGGGGCTGGGAGGG - Intronic
1034284463 7:149875337-149875359 AGAGAAGGGAAATGAAGGGAAGG + Intronic
1034376094 7:150645838-150645860 AGGGAAGAGAAAACCTGTGAAGG - Intergenic
1034530153 7:151690532-151690554 AGGAAGGTGCAAGGCTGGGAGGG + Intronic
1034653668 7:152712637-152712659 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1034840050 7:154387311-154387333 AGGGAACTGAAAGACTAGGAGGG + Intronic
1034907614 7:154964547-154964569 AGGGGAGTGAAAAGCAGGGATGG - Intronic
1035744360 8:1950996-1951018 AGGGATGTGAGATACTGGGAAGG - Intronic
1036096166 8:5726564-5726586 AGGGAAATGAATTGCAAGGAGGG + Intergenic
1036505206 8:9348549-9348571 AGGGAAGGGAAATGAAGAGAAGG - Intergenic
1036635524 8:10547646-10547668 AGGGAAGGGAAAAGGAGGGACGG - Intronic
1037308301 8:17528738-17528760 AGGGGAGAGAAATCTTGGGAAGG + Intronic
1037542441 8:19885520-19885542 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1037685928 8:21139372-21139394 GGGTAAGTGCAATGCAGGGATGG + Intergenic
1037738269 8:21583814-21583836 AGGGAAATGAAAAGGGGGGAAGG - Intergenic
1037745978 8:21644421-21644443 AGGGAACAGATGTGCTGGGAAGG - Intergenic
1038008184 8:23451877-23451899 AGGGAAGGGAATTGCTGGGGAGG - Intronic
1038862305 8:31401216-31401238 TGGGGAGGGAAGTGCTGGGAAGG + Intergenic
1039934560 8:42030343-42030365 AGGGAAGTGAACAGCTGGCCTGG - Intronic
1040103559 8:43525768-43525790 TGGGGAGTGAAATGTGGGGATGG + Intergenic
1041192721 8:55369413-55369435 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1041586193 8:59523122-59523144 TGGGCAGGGAAATGCTGGGAAGG + Intergenic
1042533948 8:69840394-69840416 AGGGAAGGGAAAGGATGGGAAGG + Intergenic
1043004274 8:74798787-74798809 AGGGAAAAGAAATGGAGGGAAGG + Intronic
1043082091 8:75779460-75779482 AGGGCAGCAAAATGCAGGGATGG - Intergenic
1043238541 8:77900149-77900171 ACGGAAGGGAAGTGCTGGGAAGG - Intergenic
1043483376 8:80675075-80675097 AAGGAAGTGAAATTCTAGTAGGG + Intronic
1045234989 8:100343833-100343855 AGGGAAGCTAAATGATGGTAAGG - Intronic
1047413876 8:124648122-124648144 AAGGCTTTGAAATGCTGGGATGG - Intronic
1047640982 8:126821271-126821293 GGGGAAGGGAAGTGCTGGGAAGG - Intergenic
1048198672 8:132353303-132353325 AGGGAAGGGAAAGGAAGGGAAGG + Intronic
1048372057 8:133787224-133787246 AGGGAAGTGAATAAATGGGATGG + Intergenic
1050062251 9:1721728-1721750 AGGGGAGAGAAATGGAGGGAGGG + Intergenic
1051099309 9:13502826-13502848 AGGGAACTTGAAGGCTGGGATGG - Intergenic
1051143953 9:14007343-14007365 ATGGAAGGGAAGTGCTGGGAAGG + Intergenic
1051199806 9:14604228-14604250 AGAGAAGTGAAATAGTGGAATGG - Intergenic
1051440221 9:17075383-17075405 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1052467402 9:28846724-28846746 AGGGAAGTGAAATGCAGTGTAGG - Intergenic
1053801472 9:41766840-41766862 AGGGAAGAGGAATGCTCAGATGG - Intergenic
1054143727 9:61547986-61548008 AGGGAAGAGGAATGCTCAGATGG + Intergenic
1054189903 9:61978994-61979016 AGGGAAGAGGAATGCTCAGATGG - Intergenic
1054648609 9:67609597-67609619 AGGGAAGAGGAATGCTCAGATGG + Intergenic
1054902436 9:70383420-70383442 AGGGAAGGGAAGTGCTGGGGTGG - Intergenic
1055023538 9:71695207-71695229 AGGGAAGGGCATTCCTGGGAAGG - Intronic
1056291422 9:85147718-85147740 AGGGAAGTGAGAGGGTGGGCAGG + Intergenic
1056703422 9:88931211-88931233 ATAGAAGTGTCATGCTGGGAGGG - Intergenic
1057029040 9:91759663-91759685 AGTGAAATGATATGCTGGGATGG - Intronic
1057575741 9:96240985-96241007 AGGGTCGGGAAATGGTGGGATGG - Intronic
1057810035 9:98250604-98250626 AGGGAAGGGAAATGGGGAGAAGG + Intronic
1058339178 9:103873093-103873115 CGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1059476151 9:114549584-114549606 AAGGAGGCGAGATGCTGGGAAGG - Intergenic
1059832093 9:118107831-118107853 AGGGAAATGTAATTCTTGGAAGG + Intergenic
1060010458 9:120039046-120039068 AGGGAATAGAATTGCTGGGGAGG + Intergenic
1060347830 9:122832319-122832341 AGGGAAGAGAAAGGAAGGGAAGG - Intergenic
1060426280 9:123509414-123509436 AGCGAGGAGAAATACTGGGAAGG + Intronic
1060496980 9:124126122-124126144 AGGCAAGTGACTTGCTTGGAGGG + Intergenic
1061103016 9:128506808-128506830 AGAAAAGTGAAGTGCTGGGTTGG - Intronic
1061180620 9:129023165-129023187 AAGGAAGGGGAATGCAGGGAGGG + Intronic
1062143380 9:134972799-134972821 AGGGAAGGGAAAGGAAGGGAGGG + Intergenic
1062191399 9:135249635-135249657 AGGGAAGGGACATGAGGGGAGGG + Intergenic
1062355813 9:136161737-136161759 AGGGAAGGGAAAGGGAGGGAAGG - Intergenic
1062541137 9:137042055-137042077 CACGATGTGAAATGCTGGGATGG - Intronic
1185535572 X:858766-858788 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1185581299 X:1213092-1213114 GGGGAAGTGAAAGGAAGGGAAGG - Intergenic
1185630782 X:1514665-1514687 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1185962737 X:4563452-4563474 AGTGACTTGAAAGGCTGGGATGG + Intergenic
1186751120 X:12621878-12621900 AGGGAAGGGAAGTGAAGGGAAGG + Intronic
1186751124 X:12621893-12621915 AGGGAAGGGAAGTGAAGGGAAGG + Intronic
1186751248 X:12623066-12623088 AGGGAAGGGAAGTGAAGGGAAGG + Intronic
1186751252 X:12623081-12623103 AGGGAAGGGAAGTGAAGGGAAGG + Intronic
1187211976 X:17240937-17240959 AGGGGAGTGGGATGCAGGGAGGG + Intergenic
1187777852 X:22783947-22783969 AGAGAAAAGAAAAGCTGGGAGGG - Intergenic
1188368482 X:29339445-29339467 AGGGAATTGAAAAGTGGGGAAGG + Intronic
1189084017 X:38001144-38001166 AGGGCAGGGAAGTGCTGGGTAGG - Intronic
1189087980 X:38047207-38047229 ATGGAAGGGAAATGTGGGGATGG - Intronic
1189722720 X:43936834-43936856 TGGGAAGTGAGAAGCTGGGCAGG - Intergenic
1190203165 X:48381404-48381426 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1190207373 X:48414005-48414027 AGGGAAGGGAAAGGAAGGGAAGG + Intergenic
1191975712 X:66868763-66868785 AGGGAAGGGAAAGGAAGGGAAGG - Intergenic
1192784072 X:74321014-74321036 ACGGAAGGGAAGTGCTGGAAAGG + Intergenic
1193477958 X:81990233-81990255 AGGGAAGAGAAAGGAAGGGAAGG + Intergenic
1194211364 X:91072839-91072861 GGGTAAGGGAAGTGCTGGGAAGG - Intergenic
1195034280 X:100957258-100957280 ATGGAAGTGAAAGGTTGGGGTGG + Intergenic
1195129854 X:101841123-101841145 AGGGAATCGGAAGGCTGGGAGGG + Intronic
1195176382 X:102318700-102318722 AGGGAATCGGAAGGCTGGGAGGG - Intronic
1195182482 X:102368393-102368415 AGGGAATCGGAAGGCTGGGAGGG + Intronic
1195251928 X:103057145-103057167 GGGGAGGTGTAATGGTGGGAAGG - Intergenic
1195277569 X:103297335-103297357 AGAAAAGTGAAATGATGGGAAGG + Intergenic
1195431167 X:104791190-104791212 AGGGAAGGGAAGGGCAGGGAAGG - Intronic
1195564764 X:106327543-106327565 ATGGAAGTGAAAGGTTGGGGTGG + Intergenic
1195716019 X:107819404-107819426 AGGGCAGTGAAATGTGGGGTTGG + Intergenic
1196247154 X:113413980-113414002 AAAGAAGTGAAATGCTTGGCCGG - Intergenic
1196983964 X:121247537-121247559 AGGGTAGTGGAAGGCTGGGGAGG - Intergenic
1197611212 X:128640657-128640679 TGGTATGTGAAAAGCTGGGAGGG - Intergenic
1198167636 X:134072780-134072802 GGGGAAGGGAAGTGCTGGGAAGG - Intergenic
1198386688 X:136135389-136135411 GGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1198429093 X:136547972-136547994 AGGGAAGGGAAAGGAAGGGAAGG - Intronic
1198477501 X:137009574-137009596 AGAGAAGAGAAAGGGTGGGAGGG + Intergenic
1198606144 X:138340022-138340044 AGTGAGGTGAAAAGGTGGGAAGG + Intergenic
1198699452 X:139382088-139382110 TGGGCAGAGAGATGCTGGGAGGG - Intergenic
1198772208 X:140142821-140142843 AGAGATATGAAATGCTGGGTAGG + Intergenic
1199061415 X:143359468-143359490 AAGGAATGGAAATGCTGAGAAGG - Intergenic
1199142697 X:144331823-144331845 AGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1199268034 X:145850075-145850097 AGGGAAGGGAAGTCCTGGGAAGG - Intergenic