ID: 1118936258

View in Genome Browser
Species Human (GRCh38)
Location 14:70291480-70291502
Sequence TGAAATGTAAGATCATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118936256_1118936258 11 Left 1118936256 14:70291446-70291468 CCATATTTCATTTGTTTGTTTCC No data
Right 1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG 0: 1
1: 0
2: 2
3: 19
4: 219
1118936257_1118936258 -10 Left 1118936257 14:70291467-70291489 CCTTATCTAGATGTGAAATGTAA 0: 1
1: 0
2: 0
3: 15
4: 249
Right 1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG 0: 1
1: 0
2: 2
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118936258 Original CRISPR TGAAATGTAAGATCATCTGA AGG Intergenic
902179285 1:14675640-14675662 TGAAATGTAAGTTCTAATGATGG - Intronic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
905804372 1:40865111-40865133 TTAAATGGAAAATCATCTGGTGG - Intergenic
906553175 1:46683655-46683677 TGTACTGTAAGATCTTCTAATGG - Intronic
909850563 1:80457738-80457760 TGAAATGATAGATGTTCTGAGGG + Intergenic
910090224 1:83453413-83453435 AGAAATGTTAAATTATCTGAGGG - Intergenic
910835976 1:91510679-91510701 TGCATTGTAAGATCAGATGAAGG - Intronic
911876822 1:103176337-103176359 TGAAATATAAGAACATCTAAAGG - Intergenic
912146847 1:106804643-106804665 TGAAATGTTATTTCATCTGTAGG - Intergenic
913239019 1:116811880-116811902 TGAAAAGTAAAATCAGCAGAGGG - Intergenic
917154726 1:171984286-171984308 TGAGATGGCAGACCATCTGAAGG - Intronic
918343277 1:183584671-183584693 TGAGATTTAAGATCGGCTGAAGG + Intronic
919614941 1:199795136-199795158 TGACCTGGAAGATCACCTGAGGG + Intergenic
919667490 1:200305920-200305942 TGAAATGTAAGATAATCTCCTGG - Intergenic
921274966 1:213510360-213510382 TGTCATTTAAGCTCATCTGATGG + Intergenic
921749676 1:218777766-218777788 TAACATGTAACATGATCTGAGGG - Intergenic
922936123 1:229423963-229423985 TGAACTGGAAGATCAGCTGGAGG + Intergenic
923403131 1:233634785-233634807 GGAAAAGCAAGATCATCTGTTGG + Intronic
923732270 1:236563616-236563638 TGAAATGTAAAATGATCATATGG + Intronic
1062827030 10:578179-578201 TGATATGTAAGTTCATCTTCAGG - Intronic
1066156996 10:32689198-32689220 TTAAAAGTAAGTTCATCCGAAGG + Intronic
1067782076 10:49215040-49215062 TGAGATGTAAGCTCATCAGAGGG + Intergenic
1069953502 10:72035723-72035745 TGTACTGTAAGAACATGTGACGG + Intergenic
1071807504 10:89140774-89140796 TTAAAAAAAAGATCATCTGAAGG + Intergenic
1077552543 11:3207431-3207453 TGAAATTTCAGATCTTATGAAGG + Intergenic
1078879378 11:15433136-15433158 CAAAATGTTAGATAATCTGAGGG + Intergenic
1079143659 11:17831892-17831914 TGAACTGTAAAAACATCTCAAGG + Intronic
1081076146 11:38676276-38676298 GGGAATGTAAGATAATCTCATGG + Intergenic
1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG + Intergenic
1082641946 11:55672367-55672389 TGATATTTAAGATTATTTGATGG - Intergenic
1086760860 11:90628915-90628937 GAAAATGTTAGATTATCTGAGGG + Intergenic
1086762175 11:90645137-90645159 TTAAATATTAGATCATCTCAAGG - Intergenic
1087487701 11:98777959-98777981 TTAGATGTAGCATCATCTGAGGG - Intergenic
1087756962 11:102064418-102064440 TTAGAGGTAAGATCCTCTGAGGG - Intronic
1087860811 11:103152502-103152524 TGAAATGTAACATTATTTGTAGG + Intronic
1087885812 11:103481338-103481360 AGAAATGTAAGTTCTGCTGAAGG - Intergenic
1088877826 11:113950541-113950563 TGAAATGTATGAACATTTGGAGG - Intergenic
1090293277 11:125565241-125565263 GGAAAGGTAAAATCATCTGGGGG - Intergenic
1091573223 12:1709875-1709897 GGAAATGGTAAATCATCTGACGG - Intronic
1092598258 12:10031113-10031135 AGAAATGTAAAATAATATGAAGG + Intronic
1093257251 12:16884999-16885021 TGTAATGTTACGTCATCTGATGG - Intergenic
1093387396 12:18574834-18574856 TGAGATGTAATTTCATCTAAAGG - Intronic
1093670700 12:21871629-21871651 TGATATGAAAGAACATCTGTGGG + Intronic
1097443167 12:59636229-59636251 GGAAAAATAAGTTCATCTGAGGG - Intronic
1099223540 12:79941861-79941883 TGAAATGTAGGATAATCTCTAGG + Intergenic
1101671832 12:106882808-106882830 TAAAATGGAAGCTCCTCTGAAGG - Intronic
1104875621 12:132032349-132032371 AGAAATGTAAGTTTGTCTGAAGG - Intronic
1106228688 13:27804796-27804818 TGAGTTCTAAGATCACCTGAGGG - Intergenic
1109423476 13:62144102-62144124 TGAAATATAAAATCATCTGTAGG + Intergenic
1109582494 13:64360807-64360829 TGAGAAGTAAAATCATTTGAGGG + Intergenic
1110174345 13:72538219-72538241 TGGAATGTGAGATCTTCCGATGG + Intergenic
1110367878 13:74708153-74708175 TCAAAAGTAATATCCTCTGAGGG + Intergenic
1110862578 13:80359238-80359260 TAAAACGTGAGATAATCTGAAGG - Intergenic
1111905418 13:94250278-94250300 TGAAATGTAACATCTTTTGAAGG + Intronic
1113182506 13:107646387-107646409 TGAAATAAAATGTCATCTGATGG + Intronic
1114222747 14:20711599-20711621 AGATCTGTCAGATCATCTGATGG - Intergenic
1114299596 14:21362997-21363019 TGAGCAGTGAGATCATCTGAGGG - Intronic
1114446434 14:22792240-22792262 TGAAAGGTAAAATAATTTGAAGG - Intronic
1116278014 14:42861710-42861732 TGAAATGTAAGTAAATCTCAAGG - Intergenic
1116707559 14:48321676-48321698 TGAAATGTAAAATTATATAAAGG - Intergenic
1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG + Intergenic
1119094756 14:71819193-71819215 TGAAATGGAAGAACATTTAAAGG - Intergenic
1119207881 14:72808230-72808252 TGAAATGTAGGACCATCTGATGG + Intronic
1120562179 14:86008808-86008830 TAAAATGTAAGATAAAATGAAGG + Intergenic
1122963129 14:105108366-105108388 TGAAATGTGTGTTCACCTGATGG + Intergenic
1123497453 15:20842478-20842500 TGAAATGGGAGATAATCAGAAGG + Intronic
1123554688 15:21416120-21416142 TGAAATGGGAGATAATCAGAAGG + Intronic
1123590934 15:21853434-21853456 TGAAATGGGAGATAATCAGAAGG + Intergenic
1123665077 15:22602412-22602434 TTAAATATACGATCATATGAAGG - Intergenic
1124083396 15:26522131-26522153 TGAAATGAAACATCCTGTGATGG + Intergenic
1124318909 15:28696834-28696856 TTAAATATACGATCATATGAAGG - Intergenic
1125338950 15:38655644-38655666 TGAATTGTAGGACCATCTGAGGG - Intergenic
1127447970 15:59084908-59084930 TGAAAAGTAAGATCAGTCGAGGG - Intronic
1130799628 15:87249031-87249053 TGAAAACTAAGTTCATCTGTTGG + Intergenic
1131976948 15:97956447-97956469 TAAAATGTAAAATTGTCTGATGG + Intergenic
1132150781 15:99456732-99456754 TGCATTTTAAGATAATCTGATGG + Intergenic
1135552741 16:23410617-23410639 GGAAATGTAAAATTATTTGAGGG - Intronic
1139625157 16:68182058-68182080 AGAAATGAAAGATCATCAGAAGG + Intronic
1140593572 16:76381531-76381553 TGAAATTGACGATCACCTGAAGG - Intronic
1141525840 16:84610950-84610972 TGATATGTAACACCTTCTGAAGG + Intronic
1144416113 17:15048941-15048963 TGAAATTTAAGAACATTTGGGGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1146962441 17:36994783-36994805 TCAAGTCAAAGATCATCTGATGG - Intronic
1147987743 17:44316077-44316099 TGAAGTGTAAGATCGTCTTGGGG - Intronic
1149351928 17:55798453-55798475 TGAAATGAAAGAAAATATGAAGG + Intronic
1154455475 18:14518896-14518918 TGAAATGGGAGATAATCAGAAGG + Intronic
1155954437 18:31945175-31945197 TGAATTGTACACTCATCTGAAGG - Intronic
1157226465 18:45869687-45869709 TGAAATGCAAGAAAAGCTGAGGG - Intronic
1158281535 18:55833528-55833550 TGATATGTTAGATAAACTGAAGG - Intergenic
1159910708 18:74143315-74143337 AGAAAAGTAAATTCATCTGATGG + Intronic
1160658182 19:284748-284770 TGAAATGAAAAATCACTTGAGGG + Intronic
1162617404 19:11813510-11813532 TGAAATGAAAGATGGTCTCAGGG - Intergenic
1165679552 19:37762304-37762326 TAAAATCTAGGATCAACTGAAGG - Intronic
1167770603 19:51513319-51513341 TAGAATGTAAGATCTTCTCAAGG - Intergenic
1168173419 19:54606458-54606480 AGAAATGAAAGTTCATCAGAAGG - Intronic
926712695 2:15894666-15894688 TGCAAGGTAAAATCGTCTGAAGG + Intergenic
928602067 2:32913489-32913511 AGAAAAGTCAGATGATCTGATGG - Intergenic
928793329 2:34985382-34985404 TGAAAAATAAGCTCATCGGAGGG - Intergenic
929019871 2:37541795-37541817 TTAAATTTATTATCATCTGATGG - Intergenic
930432374 2:51295583-51295605 GGAAAAGTAAAATAATCTGAGGG - Intergenic
930497456 2:52164805-52164827 TGAAATGAAAAATAATCTGATGG - Intergenic
931523188 2:63122308-63122330 TGAAATTTAGAAGCATCTGAGGG + Intronic
932096613 2:68855599-68855621 TGAGATCTCATATCATCTGATGG - Intergenic
932338867 2:70947084-70947106 TCAAATGTAAGAACATTTGAGGG + Intronic
934657017 2:96121723-96121745 TGAAATGTCACATCCTCAGAGGG + Intergenic
936666321 2:114600316-114600338 TGAAATGTAAAATTATCTTATGG - Intronic
936840752 2:116765031-116765053 TGAAAGGTAAAATTATCTGGTGG - Intergenic
936979097 2:118247509-118247531 AGAAATGTAAGTTGATGTGATGG + Intergenic
937577788 2:123445058-123445080 TAAAATGTAAGCATATCTGAAGG + Intergenic
937766294 2:125664573-125664595 TGAAATGTTTGATCATCAAAAGG - Intergenic
938229999 2:129650100-129650122 TGAAAAGAAAGATATTCTGAAGG - Intergenic
939981611 2:148789266-148789288 TAAAAGGTAAGAATATCTGAAGG + Intergenic
940090919 2:149916094-149916116 GAAAATGTCAGATCATTTGAGGG - Intergenic
941800052 2:169649587-169649609 TGAAAAGCAAGATCTTCTCAAGG + Intronic
942173926 2:173312897-173312919 TGAATTGGAAGAGGATCTGATGG + Intergenic
942860216 2:180600096-180600118 TGAAATGTAAAAACATTTGGAGG + Intergenic
944007173 2:194923622-194923644 AGGAATGTATGATCTTCTGAAGG + Intergenic
944854813 2:203757496-203757518 TGCAATAAAAAATCATCTGAAGG - Intergenic
944950273 2:204740605-204740627 TGAAATCTAAAATCCTCTGAAGG + Intronic
945338552 2:208621587-208621609 TGAAAAGTGAACTCATCTGAAGG - Intronic
947232505 2:227902408-227902430 TGAGATGAAAGATCTTCTGGGGG + Intronic
1169543941 20:6631603-6631625 TGGATTGTTAGATTATCTGAGGG + Intergenic
1170062606 20:12275334-12275356 TTAAATGTAAGGTTATCTGTGGG - Intergenic
1170249249 20:14262126-14262148 TGAAATGTAAGATGTGCAGAGGG + Intronic
1170696874 20:18667199-18667221 TGAAATGCAATGCCATCTGATGG - Intronic
1176614006 21:9012773-9012795 AGAAATGTAAGATTATGTAAAGG + Intergenic
1176818693 21:13634421-13634443 TGAAATGGGAGATAATCAGAAGG - Intronic
1177592413 21:23187350-23187372 TGAAATACAAAATCATCTGAAGG + Intergenic
1179555686 21:42174194-42174216 TGAAAGGTAAGAGGATCGGAAGG - Intergenic
1184744294 22:46447202-46447224 TTAATTCTAAAATCATCTGAAGG + Intronic
949482872 3:4510772-4510794 TGGAATTTAACTTCATCTGAGGG + Intronic
952238353 3:31503863-31503885 TGAAATGTGTGATAATTTGAAGG + Intergenic
952649273 3:35705495-35705517 TGAAAAGTAGGATAATTTGATGG + Intronic
953287357 3:41625011-41625033 TCAAATGTAATTTCAACTGACGG + Intronic
953483935 3:43276605-43276627 TGAAAAGGGAGATTATCTGATGG - Intergenic
954781393 3:53064434-53064456 TGAGATGTTATATCATCTGCTGG + Intronic
957432726 3:80133522-80133544 TGAAATGTAAGTTACTCTTAAGG - Intergenic
957628133 3:82680996-82681018 TGAAAGGTAAAATCATCTGCTGG - Intergenic
958550378 3:95605021-95605043 TGATATAGGAGATCATCTGAAGG + Intergenic
959681642 3:109103230-109103252 TGAAATGTGATTCCATCTGAGGG - Intronic
960594322 3:119394246-119394268 TGAATTTTAGGATCCTCTGATGG + Intronic
962308415 3:134308959-134308981 GGATATGTAAGATGATCTGTTGG + Intergenic
966248762 3:177838245-177838267 TGAAATTTAAGTTCATTTCATGG - Intergenic
966733844 3:183173129-183173151 TGAAATCTAAGTTCCTCTGGTGG + Intergenic
967994692 3:195157717-195157739 TGAAATGGAAGAGCAGCTGTGGG + Intronic
970201266 4:13609493-13609515 TAATTTGTAAGAACATCTGAAGG - Intronic
971802814 4:31315044-31315066 TTAAATGTAAGAGCATCTGAAGG - Intergenic
973980865 4:56307106-56307128 TGAAATGTAGGAACCACTGAGGG - Intronic
974194634 4:58556984-58557006 AGGAATGCAAGAACATCTGAAGG - Intergenic
976133981 4:81915062-81915084 TGAAATGAAATATAATTTGAGGG - Intronic
978879743 4:113687342-113687364 TGACATGTAAGATCAATTGATGG - Intronic
978949020 4:114534765-114534787 ACAAATGTTAGAGCATCTGATGG - Intergenic
979754233 4:124320489-124320511 TGTAATGTAATGTCATCTGCAGG + Intergenic
981420020 4:144538649-144538671 TGAATTGTAATATCATCAGTGGG - Intergenic
982695070 4:158590172-158590194 AGAAATAAAAGATTATCTGAGGG + Intronic
983330596 4:166322682-166322704 TCAAATGTAAGAGCATATGATGG - Intergenic
983804574 4:171978467-171978489 TGAAATGTGAGCTGAGCTGATGG - Intronic
984164302 4:176288905-176288927 TGAATTCTACAATCATCTGAAGG + Intergenic
985331549 4:188842517-188842539 TGTAATGTAAGATTATTAGAAGG - Intergenic
986958018 5:13179339-13179361 TGAAATTTAAGATTAACTGGGGG + Intergenic
987931595 5:24406554-24406576 TTTAATGGAGGATCATCTGAAGG + Intergenic
988937879 5:36107263-36107285 TGATATGTTAAATGATCTGATGG - Intronic
991437508 5:66611803-66611825 TGACATTTAAGGACATCTGAAGG + Intronic
993805070 5:92397092-92397114 TGGAATGTAAGACACTCTGATGG - Intergenic
994548568 5:101203753-101203775 TGCCATGTAAAATCATCTGAAGG - Intergenic
994641756 5:102419431-102419453 TGAAACTAAAGTTCATCTGAAGG - Intronic
994967510 5:106693584-106693606 AAAAATGTAAGATTATATGATGG + Intergenic
995239806 5:109873014-109873036 TAGAATGTAAGCTCCTCTGAGGG + Intergenic
995921630 5:117321635-117321657 TTAAAGGTAAGAGCATCAGAAGG - Intergenic
996003903 5:118398146-118398168 TGAAAAATAAGATAATATGAGGG - Intergenic
997768690 5:136531779-136531801 TGAAATATAAGATCAAGTAAGGG - Intergenic
1000431733 5:161160664-161160686 TGCAGTGGAAGATCATCAGAGGG + Intergenic
1001929848 5:175665147-175665169 TGAGAGGTAGAATCATCTGAAGG + Intronic
1004057702 6:12157494-12157516 AGCAATGTAATATTATCTGAAGG - Intronic
1004567071 6:16807932-16807954 TGAAAATTAAGATAATTTGAGGG - Intergenic
1005347558 6:24905296-24905318 TGAAATGTTGGATCACCTGTGGG + Intronic
1005633015 6:27726367-27726389 TGAAATGAGAGTTCATCAGAAGG + Intergenic
1005655473 6:27931306-27931328 TTAAATGTAATTGCATCTGATGG + Intergenic
1007861280 6:44911542-44911564 AAAAATTTAAAATCATCTGAAGG - Intronic
1010144531 6:72651723-72651745 TGATATGTAATATCATTTTAAGG - Intronic
1010684583 6:78838230-78838252 TGACATGTAAGCTCATTTTAGGG - Intergenic
1012567157 6:100672069-100672091 TGACATTTAAGCTGATCTGAAGG - Intronic
1013240621 6:108242046-108242068 TGAAATGAAAAATTAACTGAAGG + Intronic
1016563773 6:145428333-145428355 TTAAATGTCAGAGCATATGAAGG - Intergenic
1017636680 6:156450831-156450853 TGAAATACAAGCTAATCTGAGGG - Intergenic
1018171863 6:161150222-161150244 TGAAGTGTAAGAGCACCAGACGG + Intronic
1018424733 6:163670134-163670156 TGAACTGTAATTTCATCAGATGG - Intergenic
1018576309 6:165263605-165263627 TGAAATTTAAGAATTTCTGAGGG + Intergenic
1022086266 7:27070554-27070576 TTAAATGTAAGCACATCTTATGG + Intergenic
1023135072 7:37043250-37043272 CTAAGTCTAAGATCATCTGATGG + Intronic
1023243888 7:38179474-38179496 TGAAATGAAACAGCCTCTGAGGG + Intronic
1024406102 7:48982310-48982332 AGTAATATAAGATCATTTGAAGG - Intergenic
1027307077 7:76909859-76909881 AGAAATGTTAAATTATCTGAGGG - Intergenic
1027399364 7:77791540-77791562 TGAATTTTAACAGCATCTGAAGG - Intergenic
1029825258 7:103186318-103186340 AGAACTGAAAGATGATCTGAGGG - Intergenic
1031843036 7:126770088-126770110 TGGAATCTAACATCAACTGATGG - Intronic
1032144798 7:129369444-129369466 TGAAATGTAAGTTCCTCAGGGGG - Intronic
1032496062 7:132363770-132363792 TGAAATGTAAGAACAGATGGTGG - Intronic
1033934264 7:146563764-146563786 TGAAATGAAAGATTCTGTGAAGG - Intronic
1034718571 7:153266196-153266218 TGAACTGCAAGATCATCAGTGGG - Intergenic
1036982997 8:13492167-13492189 TGAAATATGAGCTTATCTGAGGG + Intronic
1039151788 8:34514693-34514715 TGAAATGTAATTTCAACTGCTGG + Intergenic
1040119012 8:43660021-43660043 TGATATGTGAAATCATCTCATGG + Intergenic
1040410177 8:47146058-47146080 TGAAAAGGAAAAACATCTGAAGG + Intergenic
1040642457 8:49353420-49353442 TGAAATAACAGATTATCTGAAGG + Intergenic
1040731043 8:50447302-50447324 TGAAATGCAAAAACAGCTGAAGG + Intronic
1043283056 8:78493570-78493592 TGAAATGAATGTTTATCTGAAGG - Intergenic
1043854677 8:85251407-85251429 TTTAAGGTAAGATTATCTGAAGG - Intronic
1044614959 8:94130560-94130582 AGAAATGTGAGCTCATCTCAGGG - Intronic
1048915050 8:139174735-139174757 TGATGTGTAAGATGATCTCAGGG - Intergenic
1049950042 9:635011-635033 TGAAATGTAAGATGTTCTCTAGG - Intronic
1051477483 9:17523618-17523640 TGAACTGGAAGATTATCTTATGG + Intergenic
1051867875 9:21702089-21702111 TTAAATGTGAGATCATTTGAGGG - Intergenic
1051916370 9:22212963-22212985 TGAAATGTTAGCTCTTCTCAGGG + Intergenic
1052455140 9:28686916-28686938 TGAAATGAAAGATCTTTTAAAGG - Intergenic
1052620544 9:30903205-30903227 ACTAATGTAAGATCATCTCAGGG + Intergenic
1052708155 9:32018222-32018244 TGAAAACTAAGTTCATCTGTTGG - Intergenic
1053540997 9:38973624-38973646 TGAAAGGCAAAATCTTCTGAGGG - Intergenic
1053805417 9:41796672-41796694 TGAAAGGCAAAATCTTCTGAGGG - Intergenic
1054625143 9:67390283-67390305 TGAAAGGCAAAATCTTCTGAGGG + Intergenic
1055174638 9:73301855-73301877 TGAAATGCTAAATCATCTCATGG + Intergenic
1055509106 9:76977335-76977357 TGAAATGCAAGTGCATATGAAGG + Intergenic
1055796418 9:79979263-79979285 TGAAGTGGAAGAACATCTGTAGG - Intergenic
1055835743 9:80439474-80439496 TGAAATGTTATATAATTTGATGG + Intergenic
1062296054 9:135827819-135827841 GGAAATGTAAGCCCAGCTGATGG + Intronic
1203528665 Un_GL000213v1:115084-115106 TGAAATGGGAGATAATCAGAAGG + Intergenic
1186760258 X:12715805-12715827 TAAAATGTAATACCATCTGGGGG - Intronic
1186835194 X:13430588-13430610 TGAAATATGACATCATCGGATGG - Intergenic
1187474887 X:19602026-19602048 TGAACTGTGAGAGCATCTTAGGG - Intronic
1188584290 X:31753478-31753500 ACAAATATAAAATCATCTGATGG + Intronic
1188837842 X:34980082-34980104 TGCAATATAAGATCTCCTGAAGG + Intergenic
1191985913 X:66981291-66981313 AGCAATAAAAGATCATCTGAAGG - Intergenic
1192772827 X:74210913-74210935 TTAACTGTAAGATCATCATAAGG + Intergenic
1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG + Intergenic
1194275066 X:91868564-91868586 AAAAATTTAAGATCATATGAAGG - Intronic
1194808572 X:98362069-98362091 TATAATTTAAGAACATCTGATGG - Intergenic
1195672109 X:107478495-107478517 TGAATTGTAAACTCAACTGAGGG + Intergenic
1198921964 X:141739054-141739076 TGAAATGTCTGATCATCTCAGGG - Intergenic
1201634101 Y:16103338-16103360 TAAAATAAAAGATCATCAGAAGG - Intergenic
1201998274 Y:20119999-20120021 GGAAATTTGAGAACATCTGAAGG - Intergenic
1202149558 Y:21832412-21832434 GGAAATGAAATATAATCTGATGG - Intergenic