ID: 1118942149

View in Genome Browser
Species Human (GRCh38)
Location 14:70347919-70347941
Sequence GGGTTTGAAGGCTCATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 8, 2: 13, 3: 19, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118942149 Original CRISPR GGGTTTGAAGGCTCATGGAG AGG (reversed) Intronic
900329597 1:2127444-2127466 GGGTGAGAAGGCACAGGGAGGGG - Intronic
900552532 1:3263968-3263990 GGGTTCCAGGGCTCAGGGAGGGG + Intronic
902560290 1:17273147-17273169 GGGGCTGGAGGCTCAAGGAGGGG - Intronic
903145474 1:21369289-21369311 GGGTCTGCAGGCCCATAGAGGGG + Intergenic
903249676 1:22043594-22043616 GGGTTGGGGGGCTCCTGGAGAGG + Intergenic
903291473 1:22316973-22316995 GTGGTAGAAGGGTCATGGAGAGG - Intergenic
904036246 1:27560544-27560566 GGGTTTTCAGGGTCATGGTGTGG + Intronic
904658417 1:32066724-32066746 GGAAATGAAGGCTCAGGGAGGGG + Intergenic
905382294 1:37571574-37571596 GGGTTTTAAGGGTTTTGGAGTGG - Intronic
905883760 1:41480831-41480853 GGGTTTGAAGGCTCATGACTGGG - Intronic
906849838 1:49236385-49236407 GGGTGAGAAGACACATGGAGAGG - Intronic
908556893 1:65265482-65265504 AGGTGTGGAGGCTGATGGAGTGG - Intronic
910355016 1:86343310-86343332 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
912509305 1:110177464-110177486 TGGTCTGAAGGGTCATAGAGAGG - Intronic
915563068 1:156698959-156698981 GAGTGTGGAGGCTCAGGGAGAGG + Intergenic
915646435 1:157276087-157276109 GAGTTTAAAGGCTCATGGAGAGG + Intergenic
918355671 1:183705101-183705123 GGGTTTAAAGGCTCATGGAGAGG + Intronic
919267583 1:195291234-195291256 GGGTTTGTATGATCATGGTGTGG + Intergenic
920682888 1:208086004-208086026 GAGTTTGAAGGCTGATTAAGAGG - Intronic
922685744 1:227637682-227637704 GGTTTTAAGGGCTCATGGAGAGG + Intronic
923438742 1:233995266-233995288 AGGTCTGGAGGTTCATGGAGTGG + Intronic
924722868 1:246639292-246639314 GGGTTTAAAGGCTTATGGAGAGG + Intronic
1064876945 10:20005079-20005101 GGGTTTGAATGCTCATTAATGGG - Intronic
1066658985 10:37721156-37721178 GGGTCTGAAGGCACATTGGGAGG + Intergenic
1069290527 10:66773442-66773464 GAGATTGAAGCCACATGGAGAGG + Intronic
1070897323 10:79995980-79996002 GGGTTCTCAGGCTGATGGAGTGG - Intergenic
1073468387 10:103707927-103707949 GGGTTTGGAGGCAAAAGGAGAGG - Intronic
1080715176 11:34793045-34793067 GGCTTTGAAGGCTCCTGAAAAGG + Intergenic
1082632125 11:55555780-55555802 GGGTTTAAAGGCTCATGGAGAGG - Intergenic
1082635110 11:55585051-55585073 GGGTTTAAAGGCTCTTGGAGAGG - Intergenic
1083543706 11:63533494-63533516 GGGTTTTATGGGTGATGGAGAGG - Intergenic
1083687094 11:64383024-64383046 GGGCTTGTAGGCTAGTGGAGGGG - Intergenic
1084339652 11:68487771-68487793 GTGTTTTAAGGCTCATAGTGTGG + Intronic
1085348198 11:75781522-75781544 GAGTTGGGAGGCTCCTGGAGAGG - Intronic
1085803598 11:79613957-79613979 GGATTTAAAGGCTCATGGGAGGG - Intergenic
1086027559 11:82313024-82313046 GGCTTTGAAGACTGATGAAGGGG - Intergenic
1087048762 11:93866224-93866246 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
1089539630 11:119182050-119182072 GGTTATGAGGGCTCATTGAGAGG - Intronic
1094572199 12:31650996-31651018 GGGTTTGAGGGGTAATGGTGCGG - Intronic
1096492667 12:52021323-52021345 TGGTATGAAAGCTCATGGACTGG + Intergenic
1098626906 12:72682782-72682804 CTGTTTGAAGGCTCTGGGAGAGG - Intergenic
1100261672 12:92938005-92938027 GGGTCTGAAGGGTAATGGAACGG + Intergenic
1102265150 12:111477848-111477870 GGGTTTGGAGGGCGATGGAGGGG - Intronic
1105713180 13:23033291-23033313 GGGTCTGAAGGGTAATGGTGCGG - Intergenic
1105805827 13:23951128-23951150 GGGTGGAAAGGCTCATGGGGTGG - Intergenic
1112669745 13:101621278-101621300 GTGTTTGAAAGCTGATGAAGTGG - Intronic
1114237027 14:20832754-20832776 GGGTTTAAAGGCTCACGGAGGGG + Intergenic
1115274320 14:31590402-31590424 GTGTTGGAAGGGTCATTGAGGGG + Intronic
1116928186 14:50662967-50662989 GGGTTTGAAGGACAAAGGAGAGG - Intronic
1118942149 14:70347919-70347941 GGGTTTGAAGGCTCATGGAGAGG - Intronic
1119087622 14:71752199-71752221 GGGGCTGAAGGATCAGGGAGGGG - Intergenic
1122189634 14:100030562-100030584 GAGTCTGAACGCTCAGGGAGAGG - Intronic
1122664101 14:103316892-103316914 GCTTGTGAAGGCTCCTGGAGTGG - Intergenic
1123039692 14:105485437-105485459 GGGTTTCAAGGCTCATGGGCTGG + Intergenic
1125172907 15:36786854-36786876 GGGTTTGAAGGGTCAGAGAGAGG - Intronic
1125582937 15:40799969-40799991 TGGTGTGATGGCTCATGGAGAGG - Intronic
1127875805 15:63110393-63110415 GGCTTTGAAGGCAGATGAAGGGG + Intergenic
1128472200 15:67964112-67964134 GGGTTTGAAGGCTTAGTAAGTGG - Intergenic
1128529267 15:68432674-68432696 AGGTGTGGAGGCTCAGGGAGTGG - Intergenic
1132003027 15:98198948-98198970 GGGTTAGAAGAGTGATGGAGAGG + Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1133031391 16:3012879-3012901 GGGTTTTAAGGCCCAGGCAGGGG - Exonic
1133240496 16:4411662-4411684 GGGTGTGCAGGGTCGTGGAGGGG - Intronic
1133744422 16:8675684-8675706 GAGTTTGAAGACTCCTGGAAGGG - Intronic
1135165989 16:20139537-20139559 GGGTTTTAAGGGTTTTGGAGTGG + Intergenic
1139328150 16:66167655-66167677 GGGTGTGAGAGCTCATGGGGCGG + Intergenic
1140989104 16:80190997-80191019 TGGTCTGAATGCTCATGTAGAGG - Intergenic
1143869989 17:9951343-9951365 GGGTCTGAATGCTTCTGGAGTGG + Intronic
1145768535 17:27476211-27476233 AGGATTGAAGGCTAATGAAGTGG + Intronic
1146563548 17:33892460-33892482 GGGTTTGAAAGCTGATGAGGAGG - Intronic
1147745281 17:42691032-42691054 GGGTTGGAAGATTCAAGGAGGGG + Intronic
1148987208 17:51633451-51633473 GGGTTTGGTGGCTCAGAGAGTGG - Intronic
1149851123 17:60035158-60035180 GGGTTACAAAACTCATGGAGCGG - Intergenic
1149859041 17:60111349-60111371 GGGTTACAAAACTCATGGAGCGG + Intergenic
1150294303 17:63999482-63999504 GGCTGTGATGGCACATGGAGAGG + Intronic
1152306966 17:79526719-79526741 GAGTTTGAAGGGTCATGGCATGG + Intergenic
1152887418 17:82860628-82860650 GGCTTTGATGGATGATGGAGAGG + Intronic
1155657838 18:28211578-28211600 GGGTTTAAAGGCTCACGGAGAGG + Intergenic
1156145890 18:34177268-34177290 GGGATAGATGGGTCATGGAGAGG + Intronic
1157524123 18:48365910-48365932 GGGCCTGCAGGTTCATGGAGGGG + Intronic
1157920221 18:51706828-51706850 GGGTTTGAAGGCTCATGGTGAGG - Intergenic
1160492499 18:79349902-79349924 GGGTGTGAAGGTGCATGGTGGGG - Intronic
1160596758 18:79980849-79980871 GGTTTTGAAAGCACATGGACGGG - Intronic
1163939111 19:20476731-20476753 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
1168417053 19:56175862-56175884 GCGTTTGAAAGCCCCTGGAGTGG + Intergenic
925128853 2:1480534-1480556 GGGTTTGAGGGGTGATAGAGGGG - Intronic
926934952 2:18077538-18077560 GGGTTTGGAGCCTTTTGGAGTGG + Intronic
927427110 2:22993863-22993885 GGGTCAGAAGGCTCATGAATGGG + Intergenic
928420681 2:31136200-31136222 GGGTGTGAGGACTCTTGGAGAGG - Intronic
930810460 2:55534887-55534909 GGGTTTGAGTGATTATGGAGAGG + Intronic
933167880 2:79095358-79095380 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
935895763 2:107735853-107735875 GGGTTTCAAGGCTCACAGAGAGG - Intergenic
937089855 2:119198936-119198958 GGGTCTGTAGGCTCTTAGAGAGG - Intergenic
937100759 2:119266205-119266227 GGGAATGCAGGCTCATGGGGAGG - Intergenic
937774922 2:125765013-125765035 GGGTTAGATGGGTGATGGAGGGG + Intergenic
938338106 2:130516930-130516952 GGGAGTGCAGGCTCAAGGAGGGG - Intergenic
938351731 2:130603808-130603830 GGGAGTGCAGGCTCAAGGAGGGG + Intergenic
939114190 2:138041641-138041663 GGGTATGGAGGTTAATGGAGTGG + Intergenic
939496508 2:142933388-142933410 GATTTTTAAGGCTCATGGAGTGG + Intronic
939697184 2:145341179-145341201 GGGTTTACAAGCTAATGGAGAGG + Intergenic
939759255 2:146154014-146154036 GGTTTAGAAGGTTCATGGAATGG + Intergenic
940571557 2:155442525-155442547 CGGTTTGCAAACTCATGGAGAGG + Intergenic
941840709 2:170080646-170080668 GTATTTGGATGCTCATGGAGAGG + Exonic
942169889 2:173279755-173279777 GTGTTTAAAGGCTCTAGGAGTGG - Intergenic
945569696 2:211450755-211450777 GGGTTTAGAGACTTATGGAGGGG - Intronic
1170252778 20:14303746-14303768 GGGTTGGAAGACACAGGGAGTGG - Intronic
1171010964 20:21509231-21509253 GGGTTTCAAGTCTCTTGGAGCGG - Intergenic
1173501909 20:43559918-43559940 AGGCTTGAGGACTCATGGAGGGG + Intronic
1173804638 20:45916195-45916217 GGCTTTGAAGACTGAAGGAGAGG + Intergenic
1175985829 20:62763800-62763822 GGATTTGAGCGCCCATGGAGGGG + Intergenic
1178998475 21:37430314-37430336 GTGTATTAAGACTCATGGAGAGG + Intronic
1179667232 21:42921286-42921308 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
1181055222 22:20257831-20257853 GGGTGTGGGGGCTCATGGAGGGG - Intronic
1182056047 22:27355433-27355455 GGGTTTGAAAGCTGGTTGAGAGG - Intergenic
1182058619 22:27380726-27380748 GGGTCTGAGGGCTCCTGGTGAGG - Intergenic
1183544074 22:38446400-38446422 GGATCTGAAGCCTCATGGCGGGG + Intronic
950545377 3:13635084-13635106 GGGTGTGGAGGCTCAGAGAGGGG - Intronic
953749356 3:45597326-45597348 GGGTTAGGAGGCACATGGTGCGG - Intronic
955198310 3:56826605-56826627 GGTTTTGAAGGCTGATGGCATGG + Intronic
956889840 3:73601735-73601757 AGGTTTGTAGACTCATGTAGGGG - Intronic
957312956 3:78543314-78543336 GGGTTTGAGGACTCATGGCTAGG - Intergenic
961135573 3:124507111-124507133 GGATTTGAAGGTATATGGAGTGG + Intronic
965420850 3:168456344-168456366 GAGCTTGAAGGGTTATGGAGTGG + Intergenic
965872454 3:173278319-173278341 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
966434711 3:179870409-179870431 GGTTTTTAAGGGTCTTGGAGTGG - Intronic
970794028 4:19891002-19891024 AGGTTCGAAGGCTCATAGAGAGG - Intergenic
974950621 4:68580166-68580188 GGTTTTAAAGGCTCATAGAGAGG - Intronic
974959015 4:68675685-68675707 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
976227443 4:82806767-82806789 GGGTTTGCAGGTACATGGATTGG + Intergenic
976299787 4:83506890-83506912 GGGTTTGAAGGCCCATGGAGAGG + Intronic
976481926 4:85556144-85556166 GGGTTTGAGGGCTCACAGAGAGG + Intronic
978262040 4:106771509-106771531 GGGTGTGAAGGGTGGTGGAGGGG + Intergenic
978493571 4:109334622-109334644 GGGTGTGAAGGCTGATGGTGGGG - Intergenic
981366429 4:143909314-143909336 GGGTTTGAAGGACAAAGGAGAGG - Intergenic
986255700 5:6100787-6100809 GGGTCAGGAGGCCCATGGAGAGG - Intergenic
987285408 5:16451258-16451280 GGGCTTGAAGGCTTATGTAGGGG - Intergenic
987618745 5:20310959-20310981 GGGATTGAAGACTCATAAAGTGG - Intronic
987981870 5:25096209-25096231 GGCTTTGAAAGCCTATGGAGAGG - Intergenic
988030396 5:25756392-25756414 GGGTTTGGAGCCCCATGCAGAGG - Intergenic
990185339 5:53204596-53204618 GGGTTTAAAGGTTCCTGGAGAGG - Intergenic
999230582 5:150059602-150059624 GGGTTGGATGGCTCATGAATGGG - Intronic
1002915779 6:1526575-1526597 GGTTTCCAAGGCTCAGGGAGGGG - Intergenic
1003197831 6:3930688-3930710 GTGTATGAAGGCTAATGGATGGG + Intergenic
1006944767 6:37777973-37777995 GGCTTTGCAGGCTCATGGAGAGG - Intergenic
1007722001 6:43890669-43890691 GGTTTTCAGGGCTAATGGAGGGG + Intergenic
1010367038 6:75062841-75062863 AGGTTTGAAGGAACATAGAGTGG - Intergenic
1010495777 6:76532662-76532684 GGTGTTGAAGGCTCATAGGGAGG + Intergenic
1012718657 6:102711722-102711744 GGGTGAGCAGGCTTATGGAGTGG - Intergenic
1015181787 6:130368681-130368703 GGGCTTATAGGCTGATGGAGAGG + Intronic
1016058632 6:139604905-139604927 GGATTTGAAGGTTGAAGGAGAGG + Intergenic
1016292554 6:142540422-142540444 CGGTTTGAAGATTCATGGAGAGG - Intergenic
1018576419 6:165264478-165264500 AGGCTTGCAGGCTCATGCAGGGG + Intergenic
1020430591 7:8112989-8113011 GGGCTTGAAGGATCAGGCAGGGG - Intergenic
1021088541 7:16452793-16452815 GGGTTTGAAGGCTCCTAGTCTGG + Intergenic
1022003499 7:26246882-26246904 GGTTTTAAAGGCTCACGGATAGG - Intergenic
1023551560 7:41375320-41375342 GAGTTTCAAGGCTGAAGGAGAGG + Intergenic
1023828220 7:44024071-44024093 GGGCTTGAAGTCTCTGGGAGGGG + Intergenic
1026414506 7:70163929-70163951 ATGGTTGAAGGCTCTTGGAGGGG - Intronic
1027577839 7:79953200-79953222 GAGATTTAAGGCTCAGGGAGAGG - Intergenic
1029123639 7:98283623-98283645 GAGTGTGAAGGCACATGGAGGGG + Intronic
1029131545 7:98335195-98335217 GGGATTTAGGGCTCATGGAGAGG - Intronic
1029664943 7:101989120-101989142 GGCTGGGAAGGTTCATGGAGGGG - Intronic
1029756521 7:102577517-102577539 GGGCTTGAAGTCTCTGGGAGGGG + Intronic
1029774463 7:102676586-102676608 GGGCTTGAAGTCTCTGGGAGGGG + Intergenic
1032429527 7:131849541-131849563 GGGTGTTCAGGCTCAAGGAGGGG + Intergenic
1033442004 7:141388533-141388555 GGGTGTGGAGGCTGAGGGAGGGG - Intronic
1033450526 7:141458573-141458595 GGGATTGAAGGAGAATGGAGTGG + Intronic
1036225056 8:6950826-6950848 GTGTCTGTAGGCTCAAGGAGGGG - Intergenic
1036609316 8:10335696-10335718 GGGATTGAAGGCTCTGGGTGTGG - Intronic
1037312017 8:17566004-17566026 GGGCCAGAAAGCTCATGGAGTGG + Exonic
1038528278 8:28295895-28295917 GGGTTGGAAGGCAGATGCAGCGG - Intergenic
1039437456 8:37569848-37569870 GCTTCTGAAGTCTCATGGAGAGG - Intergenic
1042158277 8:65867109-65867131 GGGTTTGAAGGCTCATGGAGAGG - Intergenic
1045649159 8:104326683-104326705 GGTATTGAAGGCCCAAGGAGGGG - Intergenic
1045664254 8:104468401-104468423 GGTTATGAAGGGTCATGGGGAGG + Intergenic
1047209862 8:122832592-122832614 GGGTTTGAAGTCTTATGGAGAGG + Intronic
1047718565 8:127618154-127618176 GGCTTTAAAGTCTCAGGGAGTGG - Intergenic
1047929368 8:129711611-129711633 GGGTTTCAAGGCTGATGAGGGGG + Intergenic
1049384604 8:142335735-142335757 GGGGTTGATGGCTACTGGAGTGG - Intronic
1050132648 9:2428709-2428731 TGGTAGGAAGGCACATGGAGAGG + Intergenic
1054825063 9:69565482-69565504 GGGTATGAAGTTCCATGGAGAGG - Intronic
1060464892 9:123894976-123894998 AGGTATGAATGCTCATGCAGAGG + Intronic
1060624850 9:125102540-125102562 ATGTTTGAAGGCTGAGGGAGAGG - Intronic
1188425152 X:30037683-30037705 GGATATGAAGGCCCAAGGAGAGG - Intergenic
1190194981 X:48309144-48309166 GGTTTTGAAGACACACGGAGTGG - Intergenic
1190661414 X:52657347-52657369 GATTTTGAAGACACATGGAGTGG - Intronic
1191868968 X:65729380-65729402 AGGTTTTAAGGGTAATGGAGTGG - Intronic
1192282326 X:69699812-69699834 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1192282333 X:69699845-69699867 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1192945983 X:75966068-75966090 GGGTTTAAAGGCTCTTGGAGAGG + Intergenic
1194419494 X:93655924-93655946 GGCTGGGAAGGGTCATGGAGGGG + Intergenic
1197904717 X:131412682-131412704 GGTGTTGAAGGCTCACAGAGAGG - Intergenic
1201460187 Y:14213899-14213921 GGGTCTGAAGGATCAAGGGGAGG - Intergenic