ID: 1118944387

View in Genome Browser
Species Human (GRCh38)
Location 14:70370788-70370810
Sequence GGACAAGTTGAAGACCCTTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118944387 Original CRISPR GGACAAGTTGAAGACCCTTA AGG (reversed) Exonic
903637177 1:24829225-24829247 GGACAATTTTAAGACCTTTTAGG + Intronic
907816767 1:57925949-57925971 GGGCTAGCTGAAGAGCCTTAAGG + Intronic
911838161 1:102647409-102647431 GAACAATTTAAAGACCATTATGG - Intergenic
914247002 1:145893614-145893636 GGCCAAGTTCAAGTCCCTGACGG - Exonic
916628644 1:166587892-166587914 CGATAAGTTGAAGACCTTAAGGG - Intergenic
916703699 1:167324699-167324721 GGCCTAGTTAATGACCCTTAGGG - Intronic
918957518 1:191229246-191229268 GGACAAGATGTAGACGCATAAGG - Intergenic
919270431 1:195336008-195336030 GTACAAATTGAAGATCTTTATGG - Intergenic
924373505 1:243382144-243382166 GGACCAGCAGAAGAGCCTTATGG + Intronic
1064722857 10:18247323-18247345 GGACAAGAAGAAGATCCTGAGGG - Intronic
1065501486 10:26387352-26387374 GGAGAAGATGAAGACCCATCTGG - Intergenic
1066796966 10:39132993-39133015 GGACACTTTGGAGTCCCTTAAGG + Intergenic
1068005053 10:51383259-51383281 GGACAAGTTGATGAACCTCTTGG - Intronic
1068174734 10:53443728-53443750 AGACAATTTGAATACCCTTTTGG + Intergenic
1070333578 10:75435011-75435033 TAACAAGTTAAAGACCCCTACGG - Intronic
1076224581 10:128763932-128763954 GGAGGAGTGGAAGACCCTGAGGG + Intergenic
1078929229 11:15900810-15900832 GGCCAAGTTGAGGCCCCTCAAGG - Intergenic
1080395688 11:31887767-31887789 GGTCAAGTGGAAGAGGCTTAAGG - Intronic
1080948559 11:37002514-37002536 GAACAAGTTGAAGACATGTATGG - Intergenic
1088346570 11:108833702-108833724 GGTCAAGTTGAAGAGCTTTAGGG - Intronic
1089004310 11:115078188-115078210 GGAGCTGGTGAAGACCCTTAGGG + Intergenic
1093903084 12:24658947-24658969 GGACAACTTAAAGACACTGATGG + Intergenic
1093989450 12:25573576-25573598 GGACCAGCTGAACACCCTTCTGG - Intronic
1094648914 12:32356053-32356075 GGAGGAGTCGAAGGCCCTTAAGG - Intronic
1095375459 12:41522714-41522736 GCACATGTTTAAGACCATTAAGG - Intronic
1105955662 13:25280130-25280152 TGACAAGCTTAAAACCCTTAAGG - Intronic
1106843652 13:33713337-33713359 GGAGAAGAAGAAGACCCTGAAGG - Intergenic
1106935954 13:34720155-34720177 GGAAAAGTTGATGCCCTTTAAGG + Intergenic
1110452444 13:75651828-75651850 GATCAAGTTCAAGACCCTTATGG + Intronic
1114217100 14:20665196-20665218 GGAAAAGCTGCAGACCCTCAAGG - Intergenic
1117006226 14:51423656-51423678 GGACAAGCTGCAGAACCTTCCGG - Intergenic
1118944387 14:70370788-70370810 GGACAAGTTGAAGACCCTTAAGG - Exonic
1121482285 14:94288482-94288504 GGACAAGTACAAGACCATTAAGG - Exonic
1130755340 15:86756833-86756855 GGATAATTGGAAGACACTTAAGG + Intronic
1131327770 15:91465468-91465490 GGACAAGATGTTGATCCTTATGG + Intergenic
1132536977 16:487070-487092 CGCCAAGTTGAAGACCCTATTGG + Intronic
1138336697 16:56259038-56259060 TGACCAGCTGAAGAGCCTTAGGG + Intronic
1139082132 16:63535341-63535363 GGAAAAGTCAAAGACCCCTATGG - Intergenic
1143684259 17:8501365-8501387 GAACAATTTGAAGACCCCTAGGG - Intronic
1144785685 17:17830467-17830489 GGACAAGTCCAAGAACCTTCAGG - Intronic
1147414587 17:40279251-40279273 GGGCAGGTTGAAGCCCCTCATGG + Exonic
1149338762 17:55664990-55665012 GGAAAAGTTGAAGACCTCTTTGG - Intergenic
1152750629 17:82060906-82060928 GGCCAAGGTGAAGACCCTGGAGG - Exonic
1162744889 19:12792662-12792684 GGACAAGGTGAAGACGCTCAAGG + Exonic
1163421479 19:17215819-17215841 GGACATGTTGCAGGCCCTGAAGG + Exonic
927826887 2:26315535-26315557 GGACATGTTGGAGACGCTGAGGG + Exonic
928057117 2:28067815-28067837 GGAAGAGTTGAAGCTCCTTATGG + Intronic
928625699 2:33137906-33137928 GGACAAGGTGAAGGACCTCATGG + Intronic
934121656 2:88846020-88846042 GGTCAAGGAGAAGACCCTTTGGG - Intergenic
937252415 2:120533355-120533377 GGACAAGATGAAGGCCCTGTGGG + Intergenic
938971557 2:136437737-136437759 GGACAGGATGCAGACCCTGAGGG - Intergenic
944788291 2:203096510-203096532 GGGCAAGTTGAAGGCCTTTTGGG + Intronic
946728123 2:222682345-222682367 GGAAAAGTTGAAGACGATGAGGG - Intronic
947048789 2:226018885-226018907 GGACATGTCAAAGACCCTTGTGG - Intergenic
948351472 2:237344586-237344608 GGACAAGATTAAGAACCTTCAGG - Exonic
1168974141 20:1951597-1951619 GGACAGGCTGAGGAGCCTTACGG + Intergenic
1170463531 20:16601442-16601464 GGCCAAGCTGAAGACCCCAAGGG - Intergenic
1172459066 20:35101555-35101577 GGACAAGTTTAAGTCCCACAGGG - Intergenic
1175860026 20:62144924-62144946 GGTCAAGGTGAACCCCCTTAGGG - Intronic
1178104269 21:29300139-29300161 GGACATCTTGAAGAAGCTTAGGG + Intronic
1181336742 22:22140742-22140764 AGAGAAGTTGAAGACTATTATGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182830943 22:33304135-33304157 GGACTAGATGATGACCCTAAGGG + Intronic
949494475 3:4619183-4619205 GGACAAGGAGAAGATCCTTAAGG - Intronic
951065327 3:18258150-18258172 GGACAAGATGAAGATCTATAAGG + Intronic
954040677 3:47884974-47884996 GGACAACAGGAAGGCCCTTATGG + Intronic
956329634 3:68091918-68091940 GGACAAGGTGAAAACTGTTAAGG - Intronic
956742628 3:72287012-72287034 GGAAACTTTGAAGACCCTAAAGG - Intergenic
964159401 3:153628706-153628728 GGACAAGTTGAAGAAACATCTGG - Intergenic
964762986 3:160152191-160152213 GCACAAGTTGAATACCCACAAGG - Intergenic
965366052 3:167801271-167801293 GAATAAGTTGAAGAGCCATATGG - Intronic
970047785 4:11875815-11875837 GGAAAAGTTGCAGACACTCAAGG - Intergenic
972012893 4:34206349-34206371 GGAAAAGTTGCAGACACTAAAGG + Intergenic
973147318 4:46843418-46843440 GGACAAGTTGATGACTCTCTCGG - Intronic
973616605 4:52685133-52685155 AGAAAAGTTGAAGAACTTTAAGG - Intergenic
976048023 4:80976244-80976266 GGTCATGTTTAAGAGCCTTAAGG + Intergenic
980646153 4:135644480-135644502 GGAAAACTTGCAGACCCTCAAGG + Intergenic
981758621 4:148169054-148169076 ATACAAGTTGAAGCCCCTGAAGG + Intronic
982429311 4:155304598-155304620 GGAGAAGAGGAACACCCTTAGGG + Intergenic
984583736 4:181539265-181539287 GAAAAAGTTGAAGAACCTTTGGG - Intergenic
985801747 5:2009018-2009040 GGACAAGTCCAGGACCCTGAGGG - Intergenic
1003295800 6:4826565-4826587 GGGAAAGTAGAAGACACTTAGGG - Intronic
1006591699 6:35162803-35162825 GGACAAGTTGATCACCCTCCTGG - Intergenic
1013878897 6:114869244-114869266 GGACAAGTCAAGTACCCTTAAGG - Intergenic
1015040918 6:128717801-128717823 GGCCAAGTAGGAGACACTTATGG - Intergenic
1017375127 6:153760094-153760116 GGGCAAGCTGCAGACCCTTTGGG - Intergenic
1019307244 7:341586-341608 GGACCAGATGAAGACCACTAGGG - Intergenic
1022292121 7:29014824-29014846 GGACCTGCTGAAGACCCTTCTGG + Intronic
1031479142 7:122257340-122257362 GGACAAGTGGAAGTTCCTGAAGG + Intergenic
1032678263 7:134153606-134153628 GGGCAAGTTGTTGACCCTTCTGG - Intronic
1038103349 8:24405386-24405408 TGACAAGTGAAAGACCATTATGG - Exonic
1050599217 9:7233860-7233882 GGAAAAGTTGCAGAGCATTAGGG + Intergenic
1053724983 9:40990652-40990674 GGACAAGTTGAAGAAGCTGTTGG - Intergenic
1055778969 9:79798615-79798637 GGTCAAGTTGAGGACCCTTCAGG - Intergenic
1186786344 X:12959522-12959544 GGGCTAGTTGAAGACCCTTTGGG + Intergenic
1191263210 X:58352119-58352141 GGACAATTTGGAGTTCCTTAAGG + Intergenic
1191578045 X:62728702-62728724 GGAAAAGTTGAATATCCTGAAGG - Intergenic
1197599982 X:128517599-128517621 GAACAAGTTGGAGAGCCTTGGGG - Intergenic
1199572214 X:149277968-149277990 GCACAAGCTGCAGCCCCTTAAGG + Intergenic
1201779295 Y:17700913-17700935 GGACATTTTGGAGACCCTTGAGG - Intergenic
1201822261 Y:18205079-18205101 GGACATTTTGGAGACCCTTGAGG + Intergenic