ID: 1118949719

View in Genome Browser
Species Human (GRCh38)
Location 14:70423785-70423807
Sequence CTTTCCTCCACATCCTCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118949719_1118949724 -1 Left 1118949719 14:70423785-70423807 CCTGGCGAGGATGTGGAGGAAAG No data
Right 1118949724 14:70423807-70423829 GGGAACACTTGTAACTTGGTGGG No data
1118949719_1118949723 -2 Left 1118949719 14:70423785-70423807 CCTGGCGAGGATGTGGAGGAAAG No data
Right 1118949723 14:70423806-70423828 AGGGAACACTTGTAACTTGGTGG No data
1118949719_1118949725 25 Left 1118949719 14:70423785-70423807 CCTGGCGAGGATGTGGAGGAAAG No data
Right 1118949725 14:70423833-70423855 GTAAATTAGTACAACCACTATGG No data
1118949719_1118949722 -5 Left 1118949719 14:70423785-70423807 CCTGGCGAGGATGTGGAGGAAAG No data
Right 1118949722 14:70423803-70423825 GAAAGGGAACACTTGTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118949719 Original CRISPR CTTTCCTCCACATCCTCGCC AGG (reversed) Intergenic