ID: 1118950567

View in Genome Browser
Species Human (GRCh38)
Location 14:70433189-70433211
Sequence ATGCTGACTCAGAGCATACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118950563_1118950567 19 Left 1118950563 14:70433147-70433169 CCAGTGAATCCTGGCTATAGGAG No data
Right 1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG No data
1118950561_1118950567 25 Left 1118950561 14:70433141-70433163 CCTGGACCAGTGAATCCTGGCTA 0: 8
1: 112
2: 232
3: 214
4: 260
Right 1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG No data
1118950564_1118950567 10 Left 1118950564 14:70433156-70433178 CCTGGCTATAGGAGAAACAGTAC No data
Right 1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118950567 Original CRISPR ATGCTGACTCAGAGCATACA CGG Intergenic
No off target data available for this crispr