ID: 1118953153

View in Genome Browser
Species Human (GRCh38)
Location 14:70453300-70453322
Sequence CATTGGAATAAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 2, 1: 0, 2: 1, 3: 41, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118953153 Original CRISPR CATTGGAATAAGAGGGAAGA TGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900856343 1:5188072-5188094 CTTTGTAATAACAGGGTAGAAGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901736017 1:11312675-11312697 CACTGGAATAAAAGGGCAGATGG + Intergenic
901799168 1:11697554-11697576 CATTGGGATAGGAGGGAACCAGG - Intronic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
904848849 1:33441632-33441654 CATTAGAAAAAGAAGAAAGAAGG - Intergenic
904895511 1:33814601-33814623 CATTGAAACAGGAGGGAAAAAGG - Intronic
905147477 1:35898864-35898886 AATTTGAAAAAGACGGAAGAAGG - Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909026959 1:70493386-70493408 AAGTGGAATACAAGGGAAGAGGG - Intergenic
911452596 1:98083894-98083916 AATAGGAAGAAGGGGGAAGACGG - Intergenic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
912193424 1:107368171-107368193 CATTGGAACCAGAGGTAATAAGG - Intronic
912426452 1:109596711-109596733 CTCAGGAATAAGAGGTAAGAAGG + Exonic
912493574 1:110076730-110076752 CACTGGAGGAAGAGAGAAGAGGG + Intergenic
912579895 1:110711061-110711083 CATGGGTATAAGAAGGCAGAGGG - Intergenic
913018044 1:114759033-114759055 CATTGGAATAAGTGCAATGAAGG + Intergenic
913069975 1:115289981-115290003 AATTGGAAGAAGAGAGATGAGGG - Intronic
914702551 1:150148457-150148479 CATTGGATTAGGAGGAAAGGTGG + Intergenic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
917735060 1:177912718-177912740 CACAGGAATATGGGGGAAGAGGG + Intergenic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
917793071 1:178512288-178512310 AGTTGAAATGAGAGGGAAGAAGG + Intergenic
918313548 1:183304020-183304042 CATTGGAATAAAGGGTATGAGGG - Intronic
920914716 1:210250939-210250961 CATAAGAATGAGAGAGAAGAGGG - Intergenic
921324722 1:213979420-213979442 CTTTGGAATAGGAGAGAAGAAGG + Intergenic
921774859 1:219085633-219085655 TATTTGAATAAGAAAGAAGATGG + Intergenic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922447401 1:225709047-225709069 CAGAGGAATAAAGGGGAAGATGG + Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
924556972 1:245126693-245126715 CATTTGAATCAGAGTGATGAGGG - Intronic
924773985 1:247102896-247102918 GAATGGAATAAGAGGAAATATGG + Intronic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1063038218 10:2310183-2310205 CAATGTCATAAAAGGGAAGAGGG + Intergenic
1064626101 10:17263223-17263245 TATTGGAATGAGATGGCAGATGG - Intergenic
1065806505 10:29398115-29398137 AATTGCAACAAGAGGGATGAGGG + Intergenic
1068426575 10:56873102-56873124 TATTGCAATAAGAGGGAGAATGG - Intergenic
1071930036 10:90458679-90458701 CACAGGAATAAGAGTGAGGACGG - Intergenic
1072839102 10:98750737-98750759 GATTGGGAGAAGAGAGAAGAAGG + Intronic
1073324666 10:102635285-102635307 AATTGGAAAAACAAGGAAGAGGG - Intergenic
1073354866 10:102845786-102845808 CATTGGAAAGACTGGGAAGATGG + Intergenic
1074569659 10:114612904-114612926 AATTGGAATTAGAGAGTAGAAGG - Intronic
1076673950 10:132138013-132138035 CATTTGGATGACAGGGAAGACGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078276167 11:9849568-9849590 GAATGGAATAAGAGGGAAGTGGG + Intronic
1078919677 11:15817861-15817883 GATGGGAAGAAGATGGAAGAGGG - Intergenic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1080160670 11:29171408-29171430 CCTTTGAAAAAGAGGAAAGAAGG - Intergenic
1085671574 11:78469850-78469872 AAGTGGAATAAGAAGGCAGAGGG + Intronic
1086250075 11:84802265-84802287 AATAGGAATAATAGGAAAGATGG + Intronic
1086402734 11:86473800-86473822 GATTGGAGAAAGAGGGAATACGG + Intronic
1088002974 11:104904873-104904895 CATAGGAAGAAGTGGGAATAAGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1090257273 11:125293878-125293900 CATTTGAGTAAGCGGTAAGAGGG - Intronic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1090913643 11:131143442-131143464 GATTGGAATTAGTGAGAAGAGGG + Intergenic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092957812 12:13565736-13565758 GATGGGAATGAGAGGGGAGAGGG + Intronic
1093679644 12:21987234-21987256 CATTAGAATGAGAGGTTAGATGG + Intergenic
1094192144 12:27708805-27708827 CATTGGAATATGGGGGCAGAAGG + Intergenic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1095668281 12:44828381-44828403 AATTGGAGTAAGAAGGTAGAAGG - Intronic
1096564070 12:52461533-52461555 AATTAAAATTAGAGGGAAGATGG + Intergenic
1096587136 12:52630064-52630086 CACTTGAACAAGAGGGAAAAGGG - Intergenic
1096607027 12:52774232-52774254 CACTGCATTTAGAGGGAAGAGGG - Intronic
1096689055 12:53308226-53308248 CATTAGATTAACTGGGAAGATGG + Intronic
1097860664 12:64515429-64515451 CATTGGAACAAGAGAAAGGAGGG - Intergenic
1098302233 12:69066389-69066411 CATAGGAAGATTAGGGAAGAGGG + Intergenic
1098969997 12:76843099-76843121 TCTTGGTATAAGAGGAAAGATGG + Intronic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1100440708 12:94614618-94614640 AATTGGAATAAAAGGGAAAATGG - Intronic
1100559414 12:95733165-95733187 AATGGTAATAAGAGGGAATATGG - Intronic
1100715513 12:97301418-97301440 TCTTGGAATCAGAGGTAAGATGG + Intergenic
1101136633 12:101750561-101750583 CATTTGAATAAGAAAGAAGTGGG - Intronic
1103100572 12:118170872-118170894 CATTGAAATGAGAAGGAAAAAGG - Intronic
1105758841 13:23494690-23494712 GACTGGAATAAAAGAGAAGAGGG - Intergenic
1107612322 13:42127996-42128018 CATTGGAATATGCTGGAAGTGGG - Intronic
1110239182 13:73247691-73247713 CATGGCAAGAAGAGGAAAGATGG + Intergenic
1110534477 13:76635296-76635318 GATAGCAGTAAGAGGGAAGATGG + Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111122713 13:83875754-83875776 CAATGGAAAAGGAGGAAAGAAGG - Intergenic
1111248082 13:85568390-85568412 AATTTGTATAAGAGAGAAGAAGG + Intergenic
1111629566 13:90832736-90832758 GAATGGAAAAAAAGGGAAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111858317 13:93668940-93668962 TATTCGAATAACAGGGAAAAGGG - Intronic
1112063081 13:95761642-95761664 GATAGGAACAAGAGGGAAGTAGG - Intronic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112208862 13:97352955-97352977 GATGGGGATAAGAGGGAAAATGG + Intronic
1112567959 13:100567424-100567446 CAATGGAATAATGAGGAAGATGG - Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1113536242 13:111068367-111068389 CACTGGAACAAGTCGGAAGATGG - Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115140473 14:30165113-30165135 TATGGGAAGAAGAGAGAAGAAGG + Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1116178469 14:41505082-41505104 CATTGAAATAAGGGCGTAGAAGG + Intergenic
1116735462 14:48685246-48685268 GATAGGAATTAGAGAGAAGACGG + Intergenic
1116779242 14:49217863-49217885 CAATGGAACAAGATGGAAAAAGG + Intergenic
1117896083 14:60488414-60488436 CACTGGAGTGAGAGGGAATAGGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118329039 14:64801559-64801581 CCTTGGCATATGAGGGAAGTGGG + Intronic
1118365591 14:65092915-65092937 CATTGGAATAACTGGCAAGCTGG - Intronic
1118429654 14:65703902-65703924 CTATGGAATATGAGGAAAGAGGG - Intronic
1118434341 14:65755815-65755837 CATAGGAATAAGATGGAAGAGGG - Intergenic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119158324 14:72431830-72431852 CACTGGAATAAGAGGAGAAAAGG - Intronic
1119215789 14:72868190-72868212 CATTGGAGAAAGAGGTATGAAGG + Intronic
1119257410 14:73210080-73210102 CATTGGAACAAAAGGGCATAGGG + Intronic
1121050022 14:90814280-90814302 CCCTGGAATGAGAGGGTAGATGG - Intronic
1121163847 14:91772604-91772626 GATTGGAGAGAGAGGGAAGAAGG + Intronic
1122375402 14:101253687-101253709 AATAGGAATAAGAGGGAAAAGGG - Intergenic
1123800517 15:23814994-23815016 CATTGGAATAAATAGGAAAAGGG + Intergenic
1124432691 15:29620706-29620728 CAAAGAAATAAGTGGGAAGAAGG + Intergenic
1124873418 15:33566577-33566599 GAAAGGAATAAGAGGGATGAGGG + Intronic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1125904333 15:43376612-43376634 ATTTGGAACAAGAGGTAAGAAGG + Exonic
1126491423 15:49241089-49241111 CATTGGAATAAGAGATATGGGGG + Intronic
1126684045 15:51231888-51231910 CATAGTAATAGGAGGGAAGGTGG - Intronic
1129105016 15:73301163-73301185 TACTGGAATAAGAGGGAAGGAGG - Intronic
1129354299 15:74979049-74979071 CATTGCAAGAAGCTGGAAGAAGG - Intronic
1130702114 15:86194695-86194717 AGTTAGTATAAGAGGGAAGATGG + Intronic
1131029614 15:89175581-89175603 CCTTGGGATAAGAGGAAACAGGG - Intronic
1131765269 15:95668877-95668899 CTTTGGAGTATGAGGAAAGAGGG + Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1133984760 16:10660187-10660209 CACTGGAATAAGTGGGTTGAGGG - Intronic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1135252000 16:20908112-20908134 CATTGGAGTCAGAGGGGACAGGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1138908384 16:61366328-61366350 TTTTGGAATAAGAGGTAAGTAGG - Intergenic
1140204315 16:72921423-72921445 CATAGGGCTAAGTGGGAAGACGG + Intronic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1140992701 16:80229720-80229742 TATTGGAATAAGGAGAAAGAGGG - Intergenic
1141837060 16:86548198-86548220 TATTGTAAGAAAAGGGAAGACGG - Intronic
1141938517 16:87258485-87258507 CATTTCGATAAGAGGTAAGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144282967 17:13745113-13745135 CATCTGAAAAGGAGGGAAGAAGG - Intergenic
1146458358 17:33024528-33024550 AATTGGAAGAAGAGAGGAGAGGG - Intronic
1146686597 17:34845421-34845443 CATTTGAATAATGGGGAAAATGG - Intergenic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148809944 17:50283949-50283971 CATTGGAAGAACAGGTAAGGAGG - Intergenic
1150594871 17:66595131-66595153 AATTGGAGGAACAGGGAAGAGGG - Intronic
1150851559 17:68708246-68708268 GATGGGAACAAGAGGCAAGAGGG - Intergenic
1151090900 17:71439207-71439229 CAATGGAAGAAGAGGGAACTAGG + Intergenic
1152260822 17:79266116-79266138 CATTGGAATCAAAGGAAGGAGGG - Intronic
1153333933 18:3902510-3902532 AATTGAAAGAAGAGAGAAGATGG - Intronic
1153351536 18:4085828-4085850 CATTGGAAGAAGAGGGAGTTAGG - Intronic
1154997168 18:21651781-21651803 CATGGCAATAAGAGAGAAGAAGG + Intronic
1155984716 18:32218057-32218079 CATAGGAAACAGAGAGAAGAAGG - Intronic
1155987576 18:32246295-32246317 CATTCGGAAAAGAGGGAAAATGG - Intronic
1156077349 18:33296509-33296531 CATTGGAAGAAGCTGGAGGAAGG + Intronic
1157227115 18:45876541-45876563 CATTGGAATAAAGGGTATGAAGG - Intronic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1159679096 18:71325321-71325343 CACTGGATTAAAAGGGAAGTGGG + Intergenic
1159746507 18:72242839-72242861 AATTGGAATTAGATGTAAGAGGG + Intergenic
1162599898 19:11660735-11660757 AATAGGAATAGGATGGAAGAAGG + Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1165113553 19:33515436-33515458 CATTGGGATGAAAGGGCAGAGGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
927280567 2:21302024-21302046 CAATGGAATAGGATAGAAGATGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929671391 2:43878628-43878650 CTTTGGAGTTAGAGGGCAGAAGG + Intergenic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933252065 2:80039577-80039599 CACTGGAGTCAGACGGAAGATGG - Intronic
933639687 2:84746269-84746291 TAATAGAATAAGAGGAAAGATGG + Intronic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
936444242 2:112584050-112584072 GCTTGGAACAGGAGGGAAGAGGG - Intergenic
939110735 2:138003789-138003811 TTTTGCAATAAGATGGAAGAAGG - Intronic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
941134173 2:161693029-161693051 CTTTAGAATAAAAGGGAACATGG - Intronic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
943065898 2:183085796-183085818 CATTGTAATCAGAAGGCAGAGGG + Intronic
943645227 2:190402998-190403020 CATTGGCTTATGAAGGAAGAGGG - Intergenic
943716703 2:191160427-191160449 AATTGGAAAGAAAGGGAAGAGGG + Intergenic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
943881628 2:193152808-193152830 CATAGGAATAAGAAGTTAGAAGG + Intergenic
944201694 2:197114585-197114607 TATTGGAAGATGAGGAAAGAAGG - Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
945146886 2:206747792-206747814 CACTGAAACAATAGGGAAGATGG + Intronic
945692235 2:213051689-213051711 CATAGTAATAAAAGGAAAGATGG + Intronic
945840311 2:214879984-214880006 CATTGGAAGACTAGGTAAGAGGG + Intergenic
946219467 2:218214330-218214352 GATTGAAATAAGAGGAAGGAAGG + Intergenic
946610380 2:221451318-221451340 CATTACTATAAAAGGGAAGAGGG + Intronic
946764619 2:223028897-223028919 CATTTAAATAAGTGGAAAGATGG - Intergenic
1169448252 20:5690106-5690128 AATAGGAATAATAGGGAAAATGG + Intergenic
1170968128 20:21094555-21094577 GATTTGAATAAGTGGAAAGAGGG + Intergenic
1171500656 20:25590456-25590478 TATTGGAATGGGAGGGAAGAAGG - Intergenic
1171893623 20:30740772-30740794 CATAGGAATGAGAGGGGAGGAGG + Intergenic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1176900266 21:14432808-14432830 CCTTGTAATAAGAGGGAATTTGG + Intergenic
1177603857 21:23353979-23354001 CATTGTAAGAAGAGCCAAGAGGG - Intergenic
1178056395 21:28803768-28803790 CATTTGAATAAGTGAGAAGAGGG - Intergenic
1178127913 21:29535936-29535958 CATGGAAATAAGAGAGAATAGGG - Intronic
1178220556 21:30653125-30653147 CATTGGAGAAAGAAGGGAGAAGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178446421 21:32647675-32647697 CAATGGAAGAAGAGTGAAGTAGG - Intronic
1178759941 21:35392643-35392665 CACTGGATGAAGAGTGAAGAGGG + Intronic
1181883983 22:26004446-26004468 CATTGGAATAAAAAGGAACAGGG + Intronic
1183786097 22:40030000-40030022 TGGTGGAATAAAAGGGAAGAGGG + Exonic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
949265386 3:2151282-2151304 AATGGGACTAAGAGGCAAGAAGG + Intronic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
952702441 3:36341314-36341336 AATAGGAACAAAAGGGAAGAAGG - Intergenic
952898876 3:38096707-38096729 CATTGGGATAAATGTGAAGAAGG + Exonic
954039578 3:47874656-47874678 GGTTTGAATAAGAGGGCAGAGGG - Intronic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
955096117 3:55800025-55800047 TATTGAAACAAGATGGAAGATGG + Intronic
956118234 3:65940165-65940187 GCTTGGAATAAGAGGTAGGAGGG - Intronic
956408769 3:68956990-68957012 AATTGGATTACGAGGGAATATGG + Intergenic
956581161 3:70815324-70815346 CATAGGAACAAGATGGAAGAAGG + Intergenic
957286073 3:78219096-78219118 CCTTGTAAAAAGAGGGAAAAGGG - Intergenic
961086521 3:124072472-124072494 CCTTGAAATAAAAGAGAAGATGG + Intergenic
961316121 3:126036792-126036814 TACTGGATTAAGATGGAAGATGG + Intronic
961478708 3:127165326-127165348 CACTGCATTAAGTGGGAAGATGG - Intergenic
961904098 3:130244472-130244494 AAAGGGAATAAGAGGGAAGAGGG + Intergenic
961922089 3:130437778-130437800 AATTCAAAGAAGAGGGAAGATGG - Intronic
962131455 3:132682191-132682213 CACTGGAAAAAGAGGGGAAATGG - Intronic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962877684 3:139548313-139548335 CCTTGGAAGAAAAGGGGAGATGG + Intergenic
962925899 3:139993190-139993212 TCTTGGAATAGGAGGGAAGGAGG - Intronic
963707162 3:148701721-148701743 CATTGTAATAATAGGAAACAAGG - Intronic
963718774 3:148835590-148835612 CACTTGCATAAGAGGGAAGGAGG + Intronic
964020539 3:152005109-152005131 TATTGGAATCTGAGGGAAGAGGG + Intergenic
965113186 3:164452633-164452655 CATTGGCAGAAGAGGCAAAAAGG - Intergenic
965465697 3:169028229-169028251 CATTGCAATAAGAATAAAGAAGG + Intergenic
967056235 3:185831045-185831067 GATTGGAACAAGAGGATAGATGG + Intergenic
967756256 3:193173155-193173177 AATTAGAAAAAGAGAGAAGATGG + Intergenic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
970041241 4:11799326-11799348 CATTGAAACAACAGGCAAGAAGG + Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
973185239 4:47319671-47319693 CTTTGGAATTAGAGTGAAGCTGG + Intronic
973263655 4:48188511-48188533 TATTGGAATGACTGGGAAGAAGG - Intronic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
974459925 4:62174174-62174196 CATTGGAATAAGAGTGTGAAGGG - Intergenic
974491859 4:62573557-62573579 GTTTGGCATAAGAGGGAAGATGG + Intergenic
975329358 4:73097138-73097160 CGTGGGCAAAAGAGGGAAGAAGG - Exonic
976502100 4:85802925-85802947 CATTGGAATAAAAAGGATAAAGG + Intronic
976840534 4:89427431-89427453 CATAGGAATAATAGAGAAAACGG - Intergenic
976873044 4:89819773-89819795 CATTGGACTGAGAGTGAAAATGG - Intronic
978181879 4:105807989-105808011 CATAGGATCAAGAGAGAAGAAGG - Intronic
978349072 4:107802378-107802400 AATTTGAGAAAGAGGGAAGAGGG - Intergenic
979190415 4:117849896-117849918 CACTGGCATAAGTGGGGAGAGGG - Intergenic
979434251 4:120670493-120670515 CCTTGGAGGAAGTGGGAAGAAGG + Intergenic
979666662 4:123318177-123318199 CAATGGAATAAAATGCAAGAAGG + Exonic
980305184 4:131051738-131051760 ATTTGGGATAAGAGGGAAGAGGG + Intergenic
980623007 4:135333795-135333817 CATTGGCATCCGAGGGAAAAAGG + Intergenic
981645730 4:146996601-146996623 GACTGGAATAAGATGGTAGATGG + Intergenic
982948458 4:161658134-161658156 CATTGAAATAAATGGGAATATGG - Intronic
983624769 4:169791368-169791390 CATTGGAAAGACTGGGAAGATGG - Intergenic
983907289 4:173197284-173197306 TATTGCATTAAGAGGGTAGAGGG + Intronic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
987176817 5:15320165-15320187 CATTGAAATAACAAAGAAGAGGG + Intergenic
987609232 5:20180614-20180636 CATTTGATTATGAGGTAAGATGG - Intronic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
990303252 5:54470238-54470260 CATTGGAAAATGAGGGAGGAAGG - Intergenic
990621298 5:57562212-57562234 CATTGTAGTAAGAGGCAAGTTGG - Intergenic
993397317 5:87406261-87406283 CTTTGGAGTAAGATGGAAGGGGG - Intronic
993426611 5:87772770-87772792 CACAGGAATAAGTGGGCAGAGGG + Intergenic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994660826 5:102651978-102652000 CATTTGGATATGAGGGTAGAAGG - Intergenic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
997655573 5:135551819-135551841 CAATGGAATGGGACGGAAGAGGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
998957683 5:147453915-147453937 AATAGGGATAAGAGAGAAGAGGG - Intronic
999712693 5:154332449-154332471 CATTGGAAGAACTGGGAAGAGGG - Intronic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1001444851 5:171775224-171775246 CATTTGAATTTGAGGAAAGAAGG - Intergenic
1001872069 5:175165284-175165306 CAATGGCATAGGAGGCAAGAGGG - Intergenic
1003662396 6:8074903-8074925 CACAGGAAGAAGCGGGAAGAGGG + Intronic
1004120950 6:12821794-12821816 CATTGGATTTAGAAAGAAGAAGG + Intronic
1004582457 6:16967099-16967121 CATTGGAATCTGAGGCAAAAGGG + Intergenic
1005999931 6:30956675-30956697 CATGACAATATGAGGGAAGAAGG - Intergenic
1007470547 6:42087465-42087487 AAATGGAATGAGAAGGAAGAAGG - Intergenic
1009833549 6:68969604-68969626 AATTGGATTAAGGGGGCAGATGG + Intronic
1010425479 6:75724558-75724580 AACTGGAAGAAGAGAGAAGATGG + Intergenic
1011364590 6:86568013-86568035 CATGGAAAGAAGAGGAAAGAGGG - Intergenic
1011547192 6:88494155-88494177 CATTGGAGTAAGAGATAAAAGGG - Intergenic
1011925136 6:92633337-92633359 CATTGAAATAACATTGAAGACGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014941454 6:127444927-127444949 CATTAAAATAAAAGGAAAGAAGG - Intronic
1015860970 6:137679417-137679439 CATACTAATAATAGGGAAGAAGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016589675 6:145730369-145730391 TAGTGGAATAAGGGAGAAGAAGG - Intronic
1016652108 6:146474091-146474113 CATTGAAAGACAAGGGAAGAAGG - Intergenic
1017341239 6:153324497-153324519 CTTTGGAATCAGAGAGCAGAGGG - Intergenic
1018526640 6:164718135-164718157 TAATGGAATAAGGGGGAAAAAGG + Intergenic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019660130 7:2219589-2219611 CAGAGGAATAAGGGGGCAGAGGG + Intronic
1021141588 7:17032355-17032377 CATGGAACTAAGAGGGAAGGTGG + Intergenic
1021157578 7:17230732-17230754 AATTAGGAAAAGAGGGAAGAGGG + Intergenic
1021733451 7:23619486-23619508 CATTGGAAAAATAGGCAGGAAGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1024281542 7:47723298-47723320 CATTGGGCTAAGAAGGTAGACGG - Intronic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025120625 7:56298527-56298549 CATTGTAATAAGGGAGAAGGTGG - Intergenic
1027762143 7:82292633-82292655 CATTGGAATAATAGTCAAAAAGG - Intronic
1029975787 7:104831924-104831946 CAATGGAATAAGATGGCATAAGG + Intronic
1030058190 7:105601562-105601584 CATGGGAGAAACAGGGAAGAAGG + Intergenic
1030520452 7:110591234-110591256 CACTGGAAAAAGAGAGAAAAAGG - Intergenic
1031331414 7:120469726-120469748 AATTGGTCTAACAGGGAAGATGG - Intronic
1032110213 7:129069460-129069482 CATTGGAGGAAGAGGGAAATTGG - Intergenic
1032585531 7:133142875-133142897 GGTTGGATTAAGAGGGAAGGAGG - Intergenic
1033636513 7:143217143-143217165 CACTGGAAGAAGAAAGAAGAGGG - Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1033898764 7:146110083-146110105 CAGTGGAATAAAAAGGAAAATGG - Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034709416 7:153177705-153177727 CATTAGAAAAAGAGGAAAGGAGG - Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1036415568 8:8544602-8544624 CACTGGAATCAGAAGGAACAGGG - Intergenic
1036614112 8:10375182-10375204 GATAGGAATAAGTAGGAAGAGGG - Intronic
1036653017 8:10657681-10657703 CATTGGTATAATAAGTAAGAGGG + Intronic
1038705159 8:29886590-29886612 AATTTGAATAAGAGGGGAGAGGG - Intergenic
1040817819 8:51527377-51527399 GATTGGAATTTGAGGGTAGAAGG - Intronic
1040979056 8:53226776-53226798 CATTGAAAAAGGAGTGAAGAAGG - Exonic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1042937782 8:74077804-74077826 CATTGGTAAAAGAGGTAACATGG + Intergenic
1043398184 8:79858454-79858476 GATAGGAAGAAGAGTGAAGATGG - Intergenic
1043624753 8:82242973-82242995 CATTGGATGAAGCAGGAAGAAGG + Intergenic
1044109835 8:88258657-88258679 GTTTACAATAAGAGGGAAGACGG + Intronic
1044153268 8:88809447-88809469 AGTTAGAATAAAAGGGAAGAAGG + Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1047783529 8:128131349-128131371 CATTGGATCAAAAGGGAGGATGG - Intergenic
1047806282 8:128364097-128364119 CAATGGAATAAAAGAGAAAATGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049835231 8:144730996-144731018 CATGGGATTAAGACTGAAGACGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050169813 9:2803581-2803603 AGTTTGAATAAGAAGGAAGAAGG - Intronic
1050661655 9:7889883-7889905 CATTGAGATAAGAAGAAAGAAGG + Intergenic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1057973350 9:99578249-99578271 CATTAAAATAAGAGGCCAGAAGG - Intergenic
1058031202 9:100199676-100199698 CATAGGAACAACAGGGATGATGG - Intronic
1058214435 9:102216475-102216497 CACATGAATAAGAGGAAAGATGG + Intergenic
1059107038 9:111520890-111520912 CATTGTAATAGCAGGGAAGGAGG - Intergenic
1059204951 9:112455872-112455894 CATTCTACTAAGAGGGAAGGAGG - Intronic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060833666 9:126738648-126738670 CATTGGAGTAAAAGTGAAAAGGG + Intergenic
1061647728 9:132019450-132019472 AACTGGAATAAGAGGAAAAAAGG - Intronic
1062608277 9:137358574-137358596 CAAGAGAATAAGAGGGGAGACGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1190594366 X:52038040-52038062 CGTTGGAATAAGGGGAAAGAAGG + Intergenic
1190595819 X:52052080-52052102 CACTGGAATAAATGGAAAGAAGG + Exonic
1190613005 X:52201993-52202015 CACTGGAATAAATGGAAAGAAGG - Exonic
1193618189 X:83716544-83716566 TTTTGGAATAAGAGAGATGAAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195020946 X:100827886-100827908 CAATGCAATGAGAGAGAAGATGG - Intronic
1196998011 X:121405538-121405560 CATTCAAACAAGAGGAAAGATGG + Intergenic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1198209404 X:134502735-134502757 CAATGAACTAAGAGGGCAGATGG - Intronic
1198567993 X:137924791-137924813 CATTGGAATAAAGGGGATCAAGG + Intergenic
1198722494 X:139637868-139637890 CATTAGGATAAGAGGGAGGCAGG + Intronic
1198844655 X:140897883-140897905 CATTGGAATAAGAGTGCAACAGG - Intergenic
1199369422 X:147029118-147029140 CGAAGCAATAAGAGGGAAGAGGG - Intergenic
1199604033 X:149562442-149562464 CTTTGGGATAAGAGGGAATGGGG + Intergenic
1199785280 X:151099654-151099676 CATAGGAAAAAGATGGAAGCTGG - Intergenic
1200135716 X:153873667-153873689 AATTGGATTAGGAGGGAAGCAGG - Intronic
1201565107 Y:15357498-15357520 AATTGCAAAAAGCGGGAAGAGGG - Intergenic
1201622378 Y:15974253-15974275 CATTTAAATCAGAGGAAAGAGGG - Intergenic