ID: 1118956496

View in Genome Browser
Species Human (GRCh38)
Location 14:70487915-70487937
Sequence ATGTGAAAGCAGGAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118956490_1118956496 22 Left 1118956490 14:70487870-70487892 CCAAAAAATAAAGTATATTAATT No data
Right 1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118956496 Original CRISPR ATGTGAAAGCAGGAGCAGAG GGG Intergenic
No off target data available for this crispr