ID: 1118956722

View in Genome Browser
Species Human (GRCh38)
Location 14:70489447-70489469
Sequence TGGACCCACCTGAGGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118956719_1118956722 -8 Left 1118956719 14:70489432-70489454 CCCAGAGAGCATCTCTGGACCCA No data
Right 1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG No data
1118956717_1118956722 0 Left 1118956717 14:70489424-70489446 CCTCAACTCCCAGAGAGCATCTC No data
Right 1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG No data
1118956720_1118956722 -9 Left 1118956720 14:70489433-70489455 CCAGAGAGCATCTCTGGACCCAC No data
Right 1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118956722 Original CRISPR TGGACCCACCTGAGGTTTTG AGG Intergenic
No off target data available for this crispr