ID: 1118959259

View in Genome Browser
Species Human (GRCh38)
Location 14:70513882-70513904
Sequence TATCTCATACTGATGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118959259_1118959265 3 Left 1118959259 14:70513882-70513904 CCCAATCCCATCAGTATGAGATA No data
Right 1118959265 14:70513908-70513930 CCATGTAACAAACATACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118959259 Original CRISPR TATCTCATACTGATGGGATT GGG (reversed) Intergenic
No off target data available for this crispr