ID: 1118960376

View in Genome Browser
Species Human (GRCh38)
Location 14:70524605-70524627
Sequence TCCCTTTGAAGGTGATCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 2, 2: 1, 3: 10, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118960376_1118960382 10 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960382 14:70524638-70524660 TGGAGAAGTGAAATACTGGGAGG 0: 1
1: 0
2: 0
3: 24
4: 236
1118960376_1118960384 16 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960384 14:70524644-70524666 AGTGAAATACTGGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1118960376_1118960381 7 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960381 14:70524635-70524657 TTCTGGAGAAGTGAAATACTGGG 0: 1
1: 0
2: 1
3: 13
4: 272
1118960376_1118960378 -10 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960378 14:70524618-70524640 TTCAAAGGGATCACCACTTCTGG 0: 1
1: 1
2: 0
3: 5
4: 97
1118960376_1118960385 27 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960385 14:70524655-70524677 GGGAGGGCCTGGCCTGAGAGTGG 0: 1
1: 1
2: 15
3: 59
4: 639
1118960376_1118960383 11 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960383 14:70524639-70524661 GGAGAAGTGAAATACTGGGAGGG 0: 1
1: 0
2: 4
3: 19
4: 285
1118960376_1118960380 6 Left 1118960376 14:70524605-70524627 CCTGCTGATCACCTTCAAAGGGA 0: 1
1: 2
2: 1
3: 10
4: 105
Right 1118960380 14:70524634-70524656 CTTCTGGAGAAGTGAAATACTGG 0: 1
1: 0
2: 1
3: 23
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118960376 Original CRISPR TCCCTTTGAAGGTGATCAGC AGG (reversed) Exonic
907542760 1:55231243-55231265 TCCCTATGAAGGTTTTCTGCTGG + Intergenic
914389356 1:147205269-147205291 TCCCGTTGAAGTTAATCAGTGGG - Intronic
915970096 1:160348819-160348841 TCCATCTGAAGGTTATCAGGAGG - Intronic
916802923 1:168231272-168231294 TACCTCTGAAGATGTTCAGCTGG + Intronic
919020318 1:192096616-192096638 TTCCTTTAAAGGTTGTCAGCTGG - Intergenic
922923241 1:229326686-229326708 TCCCTTTGAGAGTGGCCAGCTGG - Intronic
923566368 1:235079608-235079630 GCCCTTTGAAGATGAGAAGCCGG + Intergenic
1065247776 10:23776138-23776160 TACCATTGAAGATGATCACCTGG + Intronic
1070798934 10:79233713-79233735 TCCCTTTCAAATTCATCAGCAGG + Intronic
1073471861 10:103727507-103727529 TCCCTTTCAGGGTGGTCACCCGG - Intronic
1073478025 10:103767127-103767149 TCCCATTGAAGGTGGCCAGAAGG - Exonic
1075089148 10:119433509-119433531 TCCCTTTCTCGGTGATCACCTGG + Intronic
1081886223 11:46499051-46499073 TCCCTATGAATGATATCAGCTGG - Intronic
1085736279 11:79041981-79042003 GCCTTAGGAAGGTGATCAGCAGG + Intronic
1087483410 11:98730897-98730919 TCCCTTATGAGGTGATCATCAGG - Intergenic
1090563663 11:127962546-127962568 TCCCTTTAAAGGTGACCTGAGGG - Intergenic
1093411554 12:18874529-18874551 TCACTTTGGTGGTGACCAGCAGG + Intergenic
1094485876 12:30926053-30926075 TCCCTGTGAAGGTGCAAAGCTGG - Intergenic
1096753080 12:53775657-53775679 TCTATTTGAAGTTGTTCAGCAGG + Intergenic
1099767549 12:87007185-87007207 TCCCTTTGAATGTGGTCTGATGG + Intergenic
1100329942 12:93572674-93572696 TCTCTTTGTAGGCGATCAGTGGG + Exonic
1101582773 12:106058392-106058414 TGCCTTTGGAGATGACCAGCAGG + Intergenic
1102074763 12:110050985-110051007 TCCCTTTGCAGGTGAACACCTGG - Intronic
1102809183 12:115809238-115809260 TCCTTTTGAAGGTGATTTGCTGG + Intergenic
1108951863 13:56104544-56104566 TCTATTTGAAGGTGATCAAGGGG + Intergenic
1110462286 13:75758246-75758268 TCCCTTTTAATGTGTTGAGCTGG + Intronic
1111352845 13:87054264-87054286 TCCCTTTGAAGATGAACGACAGG - Intergenic
1115390238 14:32846123-32846145 TCCCTTTGAAAGTGCTCATTTGG - Intergenic
1116796046 14:49391287-49391309 TCCCTTTGTAGGTGACCAAAGGG - Intergenic
1117463758 14:55972316-55972338 CCCCTGTGAAGGGGAGCAGCTGG + Intergenic
1117788088 14:59308594-59308616 TCCCTTATAAGGTTACCAGCAGG - Intronic
1118931653 14:70247508-70247530 TCCCCTTGAAGGTGATCAGCAGG - Intergenic
1118953511 14:70457630-70457652 TCCCCTTGAAGGTGATCAGCAGG + Exonic
1118960376 14:70524605-70524627 TCCCTTTGAAGGTGATCAGCAGG - Exonic
1123970420 15:25503332-25503354 TCCCTTGGAAGGTCTGCAGCTGG - Intergenic
1135415740 16:22266866-22266888 TCTCTCTGAAGGTGAGCAGGTGG + Exonic
1136111939 16:28068953-28068975 TTCATTAGAAAGTGATCAGCTGG + Intergenic
1136653425 16:31693378-31693400 CCACTCTGAAGGTGATCACCAGG - Intergenic
1139301092 16:65946053-65946075 TCACTTTGAAGCTGAGCAACTGG - Intergenic
1144816040 17:18036121-18036143 TGCCATTGAAGGTTATCAGAAGG - Intronic
1148242986 17:46012454-46012476 TTCCTGTGAAGGTGCTCAGAGGG - Intronic
1152299427 17:79486419-79486441 TCCCCTTGAAGGTCAACAGTGGG - Intronic
1154411188 18:14143091-14143113 TCCCATGGAAGGGGAGCAGCAGG + Intergenic
1155725974 18:29083771-29083793 TCCCTTTGCCAGTGATCAGCAGG - Intergenic
1158259937 18:55595405-55595427 CCCCTTTAAAGGTGAGGAGCAGG + Intronic
1162013563 19:7831605-7831627 TCCCTTTGAAAGGGCACAGCAGG - Intronic
1167724093 19:51199363-51199385 TCCCTTTCAGGGTGAGAAGCTGG - Intergenic
925804422 2:7634046-7634068 TATCTTTGAAGGTGGACAGCTGG - Intergenic
927216269 2:20669369-20669391 TCCCTTTGAAGGGGGTCATATGG - Intronic
927687828 2:25184306-25184328 ACCCTGAGAAGGTGATCAGATGG - Intergenic
927899853 2:26811497-26811519 TCCCTGTGAAGGTGATTCGGGGG - Intergenic
933814263 2:86052989-86053011 GCCCTCTGCAGGTGATCATCAGG - Exonic
935085073 2:99837243-99837265 ACCCTATTAAAGTGATCAGCTGG - Intronic
935326785 2:101944859-101944881 TCCATTTGGTGTTGATCAGCTGG + Intergenic
940203102 2:151172960-151172982 TCCCTCTGGAGGTGATCAGCAGG + Intergenic
941538616 2:166754288-166754310 TCCTTTTGAATTTGATGAGCGGG + Intergenic
942185384 2:173420427-173420449 CCCCTCTGAAGATGAACAGCAGG - Intergenic
1170360957 20:15545824-15545846 TCCATTTGAAGGTTATGAGATGG + Intronic
1171130987 20:22652774-22652796 TCCATCTGAAGGAGATCAGAGGG - Intergenic
1173823571 20:46033298-46033320 TCACTTGGAATTTGATCAGCGGG + Intronic
1175379312 20:58551909-58551931 TCCAGTGGAAGGTTATCAGCAGG - Intergenic
1176861868 21:14015326-14015348 TCCCATGGAAGGGGAGCAGCAGG - Intergenic
1177697796 21:24595853-24595875 TTCCTTTGAAAGTCATCATCAGG + Intergenic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1181587939 22:23864139-23864161 TCCCCATAAAGGTGATCACCTGG - Intronic
1181922466 22:26331187-26331209 GCCCTCTGCAGGTGAGCAGCAGG + Intronic
1182959312 22:34457018-34457040 TCCCTTTGACCATGATCTGCTGG - Intergenic
1185172583 22:49302387-49302409 TCACTTTGCAGGTGATAAGCAGG - Intergenic
1185367034 22:50441503-50441525 TCCCGTGGAAGGGGAGCAGCAGG - Intronic
952870297 3:37893600-37893622 TCATTTTGAAGGTGGTTAGCAGG + Intronic
954577205 3:51683124-51683146 TCCCTGTGAAGGTGAACTGCTGG + Intronic
956230634 3:67012164-67012186 TCGCTGTGGAGGTGCTCAGCAGG - Intergenic
961075503 3:123978188-123978210 ACCCCTTGGAGGTCATCAGCAGG + Intronic
961916069 3:130376415-130376437 TGCCTTTGAAGGTGCTCAGATGG - Exonic
961933911 3:130563240-130563262 TGCCTTTGAAGGTGCTCAGGTGG - Exonic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967940371 3:194761651-194761673 GACCTTTCAAGGAGATCAGCAGG + Intergenic
968569463 4:1331807-1331829 TCCCTTTCAAGCTGACCAGCGGG - Intronic
971018039 4:22508762-22508784 TCCCTTTGAATCTGATCAGAAGG + Intronic
972989459 4:44805518-44805540 TCCCTTTAGAGGTGTTCACCAGG + Intergenic
975763430 4:77641037-77641059 TTCCTTTGAAGGGGATGATCTGG - Intergenic
985666584 5:1184283-1184305 TCTCTTTGCAGGTGCTCAACAGG + Intergenic
986154427 5:5159991-5160013 TCCCTTTGCAGGTTATCATTAGG + Intronic
986848120 5:11779590-11779612 TCACTTCGATGGAGATCAGCTGG + Intronic
986923724 5:12719314-12719336 TCACTTTAAAGGTGATAACCAGG - Intergenic
988383453 5:30529911-30529933 TCAATTTGAAGGTGCTGAGCTGG - Intergenic
990332938 5:54745368-54745390 TTCCTTTGAATGTAATCATCAGG - Intergenic
994731579 5:103498271-103498293 TGCCTCTGAAGGTTATTAGCAGG - Intergenic
998260912 5:140631398-140631420 TACCTTTGAAAGGGAGCAGCTGG + Intergenic
999394729 5:151220215-151220237 TGCCTTTGAAGGAGATAAGGAGG - Intronic
1000375063 5:160573131-160573153 GCCTTTTGAAGGTGATTAGGGGG + Intronic
1002060730 5:176624283-176624305 TCCCTTATAAGGTGGTCAGGAGG - Intronic
1004867578 6:19869187-19869209 TCCCTTTGCAAGTAATAAGCAGG - Intergenic
1007071225 6:39039778-39039800 TCACTTTGAACCTGATCCGCCGG + Intergenic
1007358822 6:41341237-41341259 TTCCTGGGAAGGTGAACAGCAGG + Intronic
1009271888 6:61624425-61624447 TCCCTGTGAGGGTGATCTCCTGG - Intergenic
1011872808 6:91918003-91918025 TCCCTTTGTCGTTGATCAGCTGG + Intergenic
1014550921 6:122789217-122789239 TGCCTTTGCACGTGATCAGTCGG + Exonic
1019059819 6:169248962-169248984 TCCCTTTGCAGCTGGTCACCAGG - Exonic
1020311423 7:6871526-6871548 CCCCTTTGAAGGTCTCCAGCTGG - Intergenic
1022143922 7:27517856-27517878 ACACTTAGAAGGTGATAAGCTGG - Intergenic
1023525131 7:41094135-41094157 TCCCTTTGATGATGATCATAGGG + Intergenic
1024468469 7:49739940-49739962 TTCCTTTGAGGGTGATGAGAAGG + Intergenic
1027258235 7:76444907-76444929 TCCCTGTCAAGATGATCAACTGG + Intergenic
1027280613 7:76607112-76607134 TCCCTGTCAAGATGATCAACTGG - Intergenic
1029316115 7:99716055-99716077 TCCCTCAGAAGGTGATTATCAGG + Intronic
1032403177 7:131637906-131637928 TCCCTGTGATGGTGATAAGGGGG - Intergenic
1040834876 8:51721126-51721148 GCCCTTTGAAGGTTGTCTGCAGG - Intronic
1041534533 8:58911201-58911223 TCCCTTTGAAAGTGTTGAACAGG + Intronic
1042503197 8:69531997-69532019 TCCCATCAAAGGTCATCAGCTGG - Intronic
1044090518 8:87994706-87994728 TCCCATTAAGAGTGATCAGCTGG - Intergenic
1048962930 8:139595088-139595110 TCCCTTTGGAGTTGGTCAGTGGG - Intergenic
1050436506 9:5616232-5616254 GCAATATGAAGGTGATCAGCAGG + Intergenic
1058936875 9:109777966-109777988 ACCCTTTGGAAGTGATCAGTTGG - Intronic
1061617784 9:131791723-131791745 CCCCTGCGCAGGTGATCAGCAGG + Intergenic
1186752831 X:12639493-12639515 TCCCCTTGAAAGTGAATAGCAGG + Intronic
1189391404 X:40580029-40580051 CACCTTTCAAGGTCATCAGCTGG + Intergenic
1198816015 X:140591138-140591160 TGCCTTTGTAGGTGACCTGCAGG + Intergenic
1202605291 Y:26634541-26634563 TTGCTTTGAAGGTCATCAGTGGG - Intergenic