ID: 1118964498

View in Genome Browser
Species Human (GRCh38)
Location 14:70567357-70567379
Sequence TTGTTGGTAGCCCATGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118964498_1118964507 15 Left 1118964498 14:70567357-70567379 CCACCAGCATGGGCTACCAACAA No data
Right 1118964507 14:70567395-70567417 CAAAGTCCCCTTAGGACAAAGGG No data
1118964498_1118964503 7 Left 1118964498 14:70567357-70567379 CCACCAGCATGGGCTACCAACAA No data
Right 1118964503 14:70567387-70567409 CAGCCTACCAAAGTCCCCTTAGG No data
1118964498_1118964510 22 Left 1118964498 14:70567357-70567379 CCACCAGCATGGGCTACCAACAA No data
Right 1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG No data
1118964498_1118964506 14 Left 1118964498 14:70567357-70567379 CCACCAGCATGGGCTACCAACAA No data
Right 1118964506 14:70567394-70567416 CCAAAGTCCCCTTAGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118964498 Original CRISPR TTGTTGGTAGCCCATGCTGG TGG (reversed) Intergenic
No off target data available for this crispr