ID: 1118964510

View in Genome Browser
Species Human (GRCh38)
Location 14:70567402-70567424
Sequence CCCTTAGGACAAAGGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118964502_1118964510 6 Left 1118964502 14:70567373-70567395 CCAACAAGGGAGTGCAGCCTACC No data
Right 1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG No data
1118964500_1118964510 19 Left 1118964500 14:70567360-70567382 CCAGCATGGGCTACCAACAAGGG No data
Right 1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG No data
1118964498_1118964510 22 Left 1118964498 14:70567357-70567379 CCACCAGCATGGGCTACCAACAA No data
Right 1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118964510 Original CRISPR CCCTTAGGACAAAGGGAATG TGG Intergenic
No off target data available for this crispr