ID: 1118964889

View in Genome Browser
Species Human (GRCh38)
Location 14:70571589-70571611
Sequence TTGTATAGGCATGGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118964889_1118964894 1 Left 1118964889 14:70571589-70571611 CCATTCTCCCCATGCCTATACAA No data
Right 1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG 0: 9
1: 42
2: 97
3: 167
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118964889 Original CRISPR TTGTATAGGCATGGGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr