ID: 1118964894

View in Genome Browser
Species Human (GRCh38)
Location 14:70571613-70571635
Sequence ATAGTACTGAAAGTCCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 9, 1: 42, 2: 97, 3: 167, 4: 357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118964891_1118964894 -7 Left 1118964891 14:70571597-70571619 CCCATGCCTATACAACATAGTAC No data
Right 1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG 0: 9
1: 42
2: 97
3: 167
4: 357
1118964890_1118964894 -6 Left 1118964890 14:70571596-70571618 CCCCATGCCTATACAACATAGTA No data
Right 1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG 0: 9
1: 42
2: 97
3: 167
4: 357
1118964892_1118964894 -8 Left 1118964892 14:70571598-70571620 CCATGCCTATACAACATAGTACT No data
Right 1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG 0: 9
1: 42
2: 97
3: 167
4: 357
1118964889_1118964894 1 Left 1118964889 14:70571589-70571611 CCATTCTCCCCATGCCTATACAA No data
Right 1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG 0: 9
1: 42
2: 97
3: 167
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118964894 Original CRISPR ATAGTACTGAAAGTCCTAGC TGG Intergenic
902102234 1:14000679-14000701 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
905708748 1:40082856-40082878 ATAGCTGTGAAAGTCCTAGATGG - Intronic
906114555 1:43348092-43348114 ATAGTCCTCAAATTCCTACCAGG + Intronic
906359733 1:45143644-45143666 ACTGTACTGAAAATCTTAGCTGG + Intronic
906756730 1:48324822-48324844 ATAGCACTGGAAGTCCTATCTGG + Intronic
906879166 1:49571585-49571607 ATACTTCTGAAAGTCCTCCCAGG - Intronic
907366050 1:53961111-53961133 ATAATAATGAATGTCCTGGCTGG + Intronic
907790583 1:57659646-57659668 ATAGCCATGAAATTCCTAGCTGG - Intronic
908601885 1:65748168-65748190 ATAGTAATGAAAGTCCTAGCTGG + Intergenic
909086735 1:71177132-71177154 ATAGAACTGAAAGTTTTGGCTGG - Intergenic
909863814 1:80639874-80639896 AAAGTACTGAAAGACCTAATGGG + Intergenic
910333392 1:86101400-86101422 ACAGTACTGGAAGTCCTGGCCGG - Intronic
911252644 1:95595289-95595311 ATAGTATCGGAAGTCCTAGCCGG + Intergenic
912032226 1:105263132-105263154 ATAGTATTGGAAGTTCTCGCTGG - Intergenic
912394576 1:109331656-109331678 ATAGTAATGGAAGTCCTAGCTGG + Intronic
912666970 1:111590281-111590303 TTAGTACTGGGGGTCCTAGCAGG - Intronic
912706283 1:111917232-111917254 ATTGTATTGAAAATCCTAGCTGG + Intronic
916379501 1:164193876-164193898 ATAGTACTGAAAATCCTAGCCGG + Intergenic
916645464 1:166780608-166780630 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
916807782 1:168276377-168276399 ACAGTACTGGAAGTTCTAGCTGG - Intergenic
916816234 1:168355692-168355714 ATAGTACTGGAAGTCCTCACTGG - Intergenic
916883024 1:169040148-169040170 ATAGTACTAAAAGTTATGGCTGG + Intergenic
917007422 1:170430556-170430578 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
917370280 1:174285634-174285656 ATAGTACTGAAAGTCCTAGCAGG - Intronic
917992437 1:180395550-180395572 CTAGTACTGAAAGGCCCAGCCGG + Intronic
918130646 1:181625342-181625364 CTAGTTATGAAAGTCCTAGATGG + Intronic
918137855 1:181691796-181691818 ATACTACTGGAAGTCCTACCTGG + Intronic
918679584 1:187335211-187335233 ATTCTACTGAAAGTCATAGCTGG + Intergenic
919215366 1:194546779-194546801 ATAGCCCTGGAAGTCCTAGCTGG - Intergenic
919269578 1:195322238-195322260 ATATTACTGGAAGTTCTATCTGG - Intergenic
920935182 1:210426354-210426376 ATAGTATTGGAAGTTCTGGCTGG - Intronic
921044235 1:211461850-211461872 ATTGTACTGGAAGTCCTAGCTGG + Intergenic
922044699 1:221933487-221933509 ATAGTACTGGAAGTCCCAGCTGG + Intergenic
922377782 1:224986807-224986829 CTAGTACTGGAAGTCCTAGCTGG + Intronic
922388186 1:225109718-225109740 GTAACACTGGAAGTCCTAGCTGG - Intronic
922392782 1:225163371-225163393 ATAGCACTGGAAGTCTTAGCTGG - Intronic
922732328 1:227956401-227956423 ACAGTACTGAATGTTCTAGCTGG - Intergenic
922911710 1:229223584-229223606 ACAGAACTGAAAGTCCAAGCTGG + Intergenic
923372025 1:233324365-233324387 CTAGTTATGAAAGTCCTAGATGG - Intergenic
923442479 1:234034356-234034378 ATAGTACTGGAAGTCCTAGCTGG - Intronic
923481217 1:234385941-234385963 CTAGCTCTGAAAGTCCTAGATGG + Intergenic
923898324 1:238297672-238297694 TTAGTTATGAAAGTCCTAGATGG - Intergenic
924241234 1:242043130-242043152 ATAATTCTGAAAGTCCTAGCTGG + Intergenic
924411559 1:243811151-243811173 ATAGTGTTGGAAGTTCTAGCCGG + Intronic
924682807 1:246255141-246255163 ATAGTCCTGGAAGTGCTAGCTGG - Intronic
924898681 1:248371543-248371565 ATAGCACTGGAAGTCTTAGCTGG - Intergenic
1062765391 10:58938-58960 ATAATTCTGAAAGTCCTGTCTGG - Intergenic
1064515260 10:16140735-16140757 ATAGTATCAAAAGTCCTGGCCGG - Intergenic
1065652120 10:27903427-27903449 ATAGTATTGGAAGTTCTGGCCGG + Intronic
1066001217 10:31105694-31105716 AGATTACTGAAAGACCTAGAAGG - Intergenic
1066097853 10:32089758-32089780 GCAGTACTAGAAGTCCTAGCCGG - Intergenic
1066136845 10:32455938-32455960 ATAGTACTGAAATTTCTGGGTGG - Intronic
1067356071 10:45528227-45528249 ACAGTACTAAAAGTCCTATCGGG + Intronic
1067366473 10:45634635-45634657 CTAGTACTAGAAGTCCTAGCTGG + Intronic
1067457633 10:46432383-46432405 ATTGTACCAAAAGTCCTAGGTGG - Intergenic
1067629567 10:47952251-47952273 ATTGTACCAAAAGTCCTAGGTGG + Intergenic
1067923628 10:50485023-50485045 ATAGTATTGGAAGTTCTGGCAGG + Intronic
1068353945 10:55885892-55885914 ATAATAAGGGAAGTCCTAGCTGG + Intergenic
1068366952 10:56064096-56064118 ATTATACTGGAAGTCCTAGTCGG - Intergenic
1068374996 10:56166188-56166210 ATTGAACTGCAAGTCCTACCAGG - Intergenic
1068441462 10:57060537-57060559 ATAGCACTGGAAGTTCTTGCAGG + Intergenic
1068482362 10:57608689-57608711 CTAGTGATGAAAGTCCTAGATGG - Intergenic
1069334880 10:67336606-67336628 CTAGCTCTGAAAGTCCTAGATGG - Intronic
1069541851 10:69300496-69300518 ATTGTACTGACAGTCTCAGCTGG - Intronic
1071000087 10:80821806-80821828 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
1071001638 10:80837786-80837808 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1071060708 10:81568951-81568973 ATAGTACTGGAAGTCCTAACCGG + Intergenic
1071258196 10:83894005-83894027 ATAGTACTGAAAAACCTAAAGGG + Intergenic
1071323897 10:84492481-84492503 ATAGTAATGAAAATCCAAGCTGG - Intronic
1071763801 10:88638710-88638732 TTAGCTCTGAAAGTCCTAGATGG + Intergenic
1071935106 10:90521260-90521282 ATAGTATTTGAAGTCCTAGCTGG - Intergenic
1072369508 10:94750519-94750541 ATAGTACTGGAAGTCCTAGCTGG - Intronic
1072850386 10:98884400-98884422 CTAGTTATGAAAGTCCTAGAGGG - Intronic
1074655148 10:115577764-115577786 ATAGTACTGATAGTACTAGCAGG - Intronic
1076808296 10:132870906-132870928 CTAGCTCTGAAAGTCCTAGAAGG - Intronic
1077471591 11:2764056-2764078 ATTGTCCAGAAAGTCCCAGCTGG - Intronic
1077721208 11:4630951-4630973 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
1077913015 11:6589964-6589986 ATAGTGCTAGAAGTTCTAGCCGG - Intronic
1078069592 11:8099612-8099634 ATGGGACTTAAAGCCCTAGCAGG + Intronic
1078336795 11:10470442-10470464 ATAGTATTGGAAGTTCTGGCAGG + Intronic
1078692049 11:13591428-13591450 ATAGTCCTGAAAGTCCTAGCTGG + Intergenic
1079621805 11:22564857-22564879 ATAATACTGGAAGTCCCACCTGG - Intergenic
1079707663 11:23640468-23640490 ATAGTACTGGAAGTACTAGCTGG + Intergenic
1080972612 11:37296634-37296656 GTAGTGCTGGAAGTCCTAGCTGG - Intergenic
1081030110 11:38069391-38069413 AGAGTACTGAAATTCCTAGCCGG - Intergenic
1081464381 11:43302769-43302791 AAAGTACTGGAAGTACTGGCAGG + Intergenic
1082689600 11:56283646-56283668 ATAGTACCGGAAGTCCTAACTGG - Intergenic
1082694301 11:56341165-56341187 ATAGCACTAGAAGTTCTAGCTGG + Intergenic
1083527904 11:63388182-63388204 ATAGCCCTTGAAGTCCTAGCTGG - Intronic
1084277118 11:68058766-68058788 GTTGTACTGAAGCTCCTAGCTGG - Intronic
1085903965 11:80737665-80737687 ATAATACAGAATGTCCAAGCTGG + Intergenic
1086143999 11:83530720-83530742 ATTATACTGAAGGTTCTAGCTGG + Intronic
1086829725 11:91545155-91545177 ATATAACTGAAAGTTCTAGCAGG + Intergenic
1087344210 11:96949946-96949968 ACATTACTGAAATTCCTGGCAGG - Intergenic
1087350427 11:97024691-97024713 ATATTACTGGAAATCCTAGTGGG + Intergenic
1087513906 11:99132381-99132403 ATAGTATTGGAAGTTCTGGCCGG + Intronic
1088331044 11:108652230-108652252 CTAGCACTGGAAGTCCTAGCTGG + Intergenic
1088413201 11:109559113-109559135 ATAGTACTGGAAGTCCTAGTTGG - Intergenic
1088435438 11:109807105-109807127 ATTGTACAGGAAGTTCTAGCTGG + Intergenic
1089952557 11:122543009-122543031 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1090195963 11:124817051-124817073 AGACAACTGACAGTCCTAGCCGG + Intergenic
1090483530 11:127089616-127089638 GTATTACTGGAAGTCTTAGCAGG + Intergenic
1090495423 11:127206617-127206639 ACTGGACTGAAAGTTCTAGCAGG - Intergenic
1090688557 11:129152864-129152886 ATAGTGCTACAAGTCCTGGCCGG + Intronic
1091925100 12:4340045-4340067 GTAGTACTGGAAGTCTTAGCTGG + Intronic
1092637261 12:10465577-10465599 ATAGTATTGGAAGTTCTGGCAGG - Intergenic
1092747396 12:11686817-11686839 AGAGCATTGAAAGTCATAGCAGG - Intronic
1093257570 12:16888957-16888979 ATAGTACTAGAAGTACTAACTGG + Intergenic
1093308643 12:17550387-17550409 GCAGAACTTAAAGTCCTAGCTGG + Intergenic
1093435096 12:19127710-19127732 CTAGCAGTGAAAGTCCTAGATGG + Intergenic
1093491994 12:19715666-19715688 ATACTATTGGAAGTCCTGGCTGG - Intronic
1093589835 12:20888702-20888724 GTAGTATTGGAAGTCCTATCAGG - Intronic
1093602216 12:21041768-21041790 GTAGTACTGGAAGTCCTAGCTGG - Intronic
1094225875 12:28045443-28045465 ATAGTACTGTAAGTCCTGTCCGG - Intergenic
1094759096 12:33508732-33508754 GTAGTACTAGAAGTCTTAGCTGG + Intergenic
1094815729 12:34181566-34181588 ATAATTCTGAAAGTCCTATCTGG - Intergenic
1095101421 12:38188949-38188971 ATAATTCTGAAAGTCCTATCTGG + Intergenic
1095181312 12:39149700-39149722 ATAACATTGGAAGTCCTAGCTGG - Intergenic
1095311963 12:40709542-40709564 TTAGCTCTGAAAGTCCTAGATGG + Intronic
1095435541 12:42183814-42183836 CTAGCTCTGAAAGTCCTAGATGG - Intronic
1095807566 12:46337062-46337084 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1097328542 12:58307243-58307265 CTAGTGATGAAAGTCCTAGATGG - Intergenic
1097645293 12:62229224-62229246 CTAGTACTGGAAGTCCTAACGGG - Intronic
1098396308 12:70021432-70021454 ATAGTACTTGAAGTCTTGGCTGG + Intergenic
1098480816 12:70958361-70958383 ATAGTACTGGGAGTCTTAGCTGG + Intergenic
1098637047 12:72797302-72797324 GTAGTATTGGAAGTTCTAGCCGG - Intergenic
1098671650 12:73237575-73237597 ATAGTACTAAAAGTCTAAGCTGG + Intergenic
1098799241 12:74932682-74932704 ATACTACTAGAAGTCCTAGTTGG + Intergenic
1099053084 12:77805180-77805202 ATAGTATTGGAAGTTCTGGCAGG - Intergenic
1099767298 12:87003997-87004019 ATAGTACTGAAAGTCCTAGCTGG - Intergenic
1100894565 12:99166246-99166268 ATTGTACTGGAGGTTCTAGCTGG + Intronic
1100944211 12:99761675-99761697 ATAGTACTGAAAGTCCTAGCTGG + Intronic
1101160582 12:101970503-101970525 ATAGTACTGGAAGTCCTAGTGGG + Intronic
1101162176 12:101989572-101989594 TTAGTACTAGAAGTCCTAGCAGG - Intronic
1101227069 12:102699221-102699243 ACAGTACTGGAAGTCCTAGCTGG + Intergenic
1102098283 12:110257733-110257755 ATAGAACTGAATGTCCAGGCTGG - Intergenic
1102259321 12:111434862-111434884 ATAGTAATGAGAGTCCGTGCCGG + Intronic
1104506651 12:129338462-129338484 ATAATCCAGAAAGTCCTAGGTGG - Intronic
1105746953 13:23386201-23386223 ATAGCTATGAAAGTCCTAGATGG + Intronic
1107218605 13:37952590-37952612 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1107296923 13:38919056-38919078 ATAGTACTATAAGTCCAAGTTGG - Intergenic
1107551085 13:41476355-41476377 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1107551737 13:41482521-41482543 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
1108744805 13:53381856-53381878 ATAGTACTGGAAGTTCTAGCTGG - Intergenic
1108770671 13:53696899-53696921 ATAGCAATGAAAGTCCTAGATGG - Intergenic
1108850242 13:54719112-54719134 TTAGTGCTGGAAGTCCTCGCCGG - Intergenic
1109100359 13:58176387-58176409 ATAGTACTAGAAGTGCTAGCTGG - Intergenic
1109858469 13:68165620-68165642 ATAGTAATGAAAGTTCTGGGAGG - Intergenic
1110122304 13:71897516-71897538 ATAGTACTGGGAGTCCTAATTGG + Intergenic
1110130139 13:71998900-71998922 ATAGTATTGGAAATACTAGCTGG - Intergenic
1110230132 13:73159179-73159201 ATAGCACTGGAAGTCCTAGCTGG + Intergenic
1110894962 13:80737800-80737822 CATGTACTGGAAGTCCTAGCTGG + Intergenic
1110903417 13:80854360-80854382 AAAGTACTGAAAATCCTAAAAGG - Intergenic
1110980937 13:81897372-81897394 ACAGTATTGAAAGTTCTGGCTGG + Intergenic
1111017520 13:82400892-82400914 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1111302969 13:86368783-86368805 ATCCCACTGGAAGTCCTAGCTGG - Intergenic
1111338409 13:86851571-86851593 ATAGTATAGGAAGTCCTGGCTGG + Intergenic
1111746650 13:92279494-92279516 ATTGTACTTAAAGTCTTATCAGG - Intronic
1112564259 13:100539220-100539242 ATAGTTCTGGGAGTCCTAGCTGG - Intronic
1114326688 14:21596037-21596059 GTAATACTGGAAGTCCTGGCTGG + Intergenic
1115124584 14:29976460-29976482 GTAGTACTGGAAGTTCTGGCCGG + Intronic
1115391986 14:32864330-32864352 ATAGTACTGGAATTCCTAGCTGG - Intergenic
1115627849 14:35212844-35212866 CTAGTTATGAAAGTCCTAGATGG + Intronic
1115740244 14:36379674-36379696 ATTCTACAGGAAGTCCTAGCCGG + Intergenic
1116021270 14:39464458-39464480 GTAGTACTGGAAGTCCTAGCTGG - Intergenic
1116075365 14:40103834-40103856 ATAGTATTGGAAGTTCTGGCAGG + Intergenic
1116140319 14:40985246-40985268 ATAGTACTAGAAGTACTAGCTGG - Intergenic
1116228952 14:42190955-42190977 ACAGAACTGAAAGTTCTAGCGGG - Intergenic
1116668518 14:47810629-47810651 GTAGTACTGAAAGTCCTAGCTGG - Intergenic
1117178680 14:53170783-53170805 GGAGAACTGAAAGACCTAGCAGG + Intergenic
1117317510 14:54587440-54587462 ATAGTACTGGAAGTCCCAGCTGG - Intronic
1117842684 14:59876480-59876502 ATAGTACTGGAAGTCTTTGCTGG - Intergenic
1118101426 14:62608711-62608733 ATAAAACTAAAAGTCATAGCAGG + Intergenic
1118560478 14:67075051-67075073 ATAGCAATGAAAGTCCTAGAAGG - Intronic
1118964894 14:70571613-70571635 ATAGTACTGAAAGTCCTAGCTGG + Intergenic
1120352668 14:83382935-83382957 ATAGTATTGGAAGTCCTAGCTGG + Intergenic
1120697810 14:87664080-87664102 ACACTACTGGAAGTCCTAGCTGG + Intergenic
1120736022 14:88053759-88053781 ATGGTACTTGAAATCCTAGCCGG - Intergenic
1121503136 14:94455043-94455065 ATAGTACTGGAAGTCCTCGCAGG - Intergenic
1123111693 14:105872240-105872262 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1124255452 15:28138315-28138337 CTAGCTATGAAAGTCCTAGCTGG - Intronic
1124568860 15:30841299-30841321 CTAGCTATGAAAGTCCTAGCTGG + Intergenic
1125262498 15:37843510-37843532 ATTTTACTGAAAATCCCAGCAGG + Intergenic
1126027082 15:44457204-44457226 ATAGCTGTGAAAGTCCTAGATGG + Intronic
1126233824 15:46358471-46358493 ACAGTCCTGGAAGTCCTAACCGG + Intergenic
1126305741 15:47254442-47254464 ATAGTACTGGAAGTACCAGCCGG - Intronic
1126395067 15:48206158-48206180 ATAGTACTGTAAGCCCCACCAGG - Intronic
1126460439 15:48909568-48909590 ATAGTAGTGGAAGTCCTAGCCGG - Intronic
1126861535 15:52888288-52888310 ATAGTACTAAAAGTTATAGCTGG + Intergenic
1126886056 15:53151725-53151747 CTAGCTCTGAAAGTCCTAGATGG - Intergenic
1126979318 15:54224146-54224168 GTAGTACTGGAAGTCCTAGCTGG - Intronic
1127556333 15:60090969-60090991 ATGGTACTGACAGTCCCAGCTGG + Intergenic
1129049224 15:72764727-72764749 CTAGCTCTGAAAGTCCTAGATGG - Intronic
1129500896 15:76036864-76036886 ATAATACTGGAAGTCCTGGCTGG + Intronic
1129575368 15:76737642-76737664 ATAGCTATGAAAGTCCTAGATGG + Intronic
1130700429 15:86174463-86174485 ATAGTACTGACAGTTCTAGCCGG - Intronic
1130807562 15:87342082-87342104 ATTGTACTGGAAGTTCTAGCTGG + Intergenic
1131314861 15:91326509-91326531 ATACTACTGGAAGTTCTAGCTGG - Intergenic
1133550438 16:6849370-6849392 ATAGAACTGAAAGGCCTGGCTGG + Intronic
1136669269 16:31840931-31840953 ATAGCACTGGAAGTTCTGGCCGG + Intergenic
1136865619 16:33750297-33750319 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
1137338599 16:47574941-47574963 ATAGTACTGGAAGTTCTATGTGG - Intronic
1138300504 16:55924043-55924065 ATAGTACTGAAAGCCCTGGCCGG + Intronic
1141363134 16:83415881-83415903 ATAGTCCTGGAAGTCCTCACAGG + Intronic
1147231178 17:39019342-39019364 CTAGTTATGAAAGTCCTAGCTGG - Intergenic
1150509299 17:65732531-65732553 CTAGTAATAAAAGTCCTAGATGG + Intronic
1150964938 17:69957278-69957300 ATGGTTCTGAGATTCCTAGCAGG + Intergenic
1151027475 17:70695608-70695630 CTAGTTGTGAAAGTCCTAGATGG - Intergenic
1151650565 17:75466501-75466523 ATGTTAATGAAAGTCCCAGCTGG - Intronic
1152958304 18:59283-59305 ATAATTCTGAAATTCCTATCTGG - Intronic
1153474618 18:5485471-5485493 ATAATACTGGAAGTCCTGGCTGG + Intronic
1153974385 18:10254677-10254699 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
1155641224 18:28017892-28017914 ACAGTACTGGAAGTCCTAGCCGG + Intronic
1155838621 18:30619788-30619810 ATAGTTCTGAAAGTCCTAGATGG - Intergenic
1157371799 18:47120179-47120201 CTAGCAATGAAAGTCCTAGGTGG + Intronic
1157380053 18:47205919-47205941 ACACTACTGGAAGACCTAGCAGG + Intergenic
1158037466 18:53050788-53050810 ATAGTACTGGAGGTCCTGGCTGG - Intronic
1159304247 18:66618598-66618620 ATAGTACTGGAAGTCCTTGCAGG + Intergenic
1159453715 18:68634949-68634971 ATAGTACTGGAAGTCCTAGATGG - Intergenic
1160117356 18:76092971-76092993 CTAGTCATGAAAGTCCTAGAAGG + Intergenic
1160611568 18:80091903-80091925 ATTGTGCTGGAAGTCCTATCCGG + Intronic
1162461946 19:10818599-10818621 AAAGTCCTGACAGTCCCAGCTGG + Intronic
1162610875 19:11750574-11750596 AAAGTACTGAAAGTCCTAGCTGG - Intergenic
1164273447 19:23694896-23694918 ATAGTGCTGGAAATCCTAGCTGG - Intergenic
1165054716 19:33167545-33167567 ATTGTACTGGAAGTGCTAGCCGG + Intronic
1165910883 19:39226316-39226338 ACAGTACTGAAAGTTCCATCTGG + Intergenic
1166277454 19:41763939-41763961 ATAGTGTTTTAAGTCCTAGCTGG - Intronic
1166632863 19:44422887-44422909 ATAGTATTGGAAGTTCTGGCTGG - Intronic
1167583582 19:50360491-50360513 ATAATACTGAACTTCCTAGCAGG + Intronic
1168018370 19:53591709-53591731 ATAGTACTGGAAGTCCTAGTCGG - Intergenic
925299755 2:2803136-2803158 CTAGCTCTGAAAGTCCTAGATGG + Intergenic
925322125 2:2980590-2980612 ATAGTACTGAAAGTCCTTGCTGG + Intergenic
925418032 2:3686948-3686970 ATAATATTGGAAGTCCTGGCTGG - Intronic
925775230 2:7328751-7328773 ATAGGACTGAAAGTACTAACAGG + Intergenic
926986969 2:18635134-18635156 ATAGTATTGGAAGTTCTGGCAGG - Intergenic
927105878 2:19825014-19825036 CTAGTAATGAAAGTCCTAGATGG + Intergenic
927299006 2:21488884-21488906 CTAGTTATGAAAGTCCTAGACGG + Intergenic
928728980 2:34208987-34209009 ATAGTACTAGAAGTCCTGGCCGG + Intergenic
928754968 2:34513456-34513478 ATAGTATTAGAAGTCCTGGCTGG + Intergenic
929273121 2:39996167-39996189 CTAGTACTTACAGTCCTACCTGG - Intergenic
929494980 2:42433119-42433141 ATTGTACTGTAAGTTCTAACTGG + Intergenic
930555537 2:52890966-52890988 ATAGTACTGGAAGTCCTAGTTGG - Intergenic
930728132 2:54701580-54701602 GTAGTACTGGAAGTCCTAGCTGG + Intergenic
931599333 2:63988032-63988054 GTAGTATTGGAAGTCCTAGCCGG - Intronic
931889692 2:66657823-66657845 TTTGTATTGAAAGTCCTGGCAGG - Intergenic
931921544 2:67021948-67021970 ATAGTACTGGAAGTCCTAACCGG + Intergenic
932069415 2:68602624-68602646 ATAGTACTGGAAGTCCTAGCTGG + Intronic
932371686 2:71194741-71194763 ATAGTATTGGAAGTCCTAGCTGG - Intronic
932935881 2:76100261-76100283 ATAGTACTGAAAGTCCTAGGTGG + Intergenic
933019144 2:77169201-77169223 ATAGTACTGGCAGTCCTAGCCGG + Intronic
933358879 2:81252125-81252147 GTAGTTCTGAAAGTCCCAGCCGG - Intergenic
933421641 2:82054332-82054354 ATAGTATTGCAAGTTCTAACTGG + Intergenic
933485212 2:82912714-82912736 ATAGTACTGGAACTCCTAGATGG + Intergenic
933545922 2:83711810-83711832 AAAGAACTTAAAGTCCAAGCTGG - Intergenic
933557085 2:83844208-83844230 ATTGTACTGGAGGTTCTAGCAGG + Intergenic
934107082 2:88704700-88704722 ATAGTACTGGAAGTTCTGGCCGG + Intronic
935081622 2:99802971-99802993 ATAGCACTGGAAGTCGTAGCTGG - Intronic
935510730 2:103970117-103970139 AGTGTACTGGAAGTCCTAGTTGG - Intergenic
935576168 2:104713051-104713073 ATAGTCCTGGAAGTCCAAGCTGG - Intergenic
935923930 2:108046948-108046970 ATATTATTTAAAGTCCAAGCAGG + Intergenic
937798605 2:126054997-126055019 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
938054631 2:128205065-128205087 ATAGTACTGAAAGTTGTGGCTGG + Intergenic
938287825 2:130132245-130132267 ATAGTACTGGAAGTCCTAAGTGG - Intergenic
938619675 2:133036796-133036818 ATAGTATTAGAAATCCTAGCTGG + Intronic
939241685 2:139569205-139569227 CAACTGCTGAAAGTCCTAGCCGG + Intergenic
940157134 2:150669389-150669411 ATAGTACTGGAAGTCCTAGCCGG + Intergenic
940438662 2:153686654-153686676 ATAGTATTGTATGTCCTGGCCGG - Intergenic
940491480 2:154367452-154367474 ACATTCCTGAAAATCCTAGCTGG + Intronic
940925562 2:159360083-159360105 ATAGTATTGGAAGTTCTGGCCGG + Intronic
941876732 2:170441280-170441302 ATAGTACTGGAAGTCTTAGCTGG - Intronic
942154393 2:173112421-173112443 ATAGTGCTGTAAGTCCTAGCCGG - Intronic
942336114 2:174888243-174888265 AAAATTTTGAAAGTCCTAGCAGG + Intronic
942733646 2:179085806-179085828 ACAGTACTGAAAGTCCTAGCTGG - Intergenic
942822329 2:180129211-180129233 TTTGTAATGAAAGTCCTAGATGG + Intergenic
943407554 2:187508809-187508831 ATAGTATTGGAAGTTCTGGCCGG - Intronic
943484345 2:188460664-188460686 ACAGTACTGGAAGTCCTAGCTGG - Intronic
943851163 2:192724717-192724739 CTAGCAGTGAAAGTCCTAGGTGG + Intergenic
944079004 2:195764366-195764388 AAAGTACTGGAAGTCCTAGTTGG + Intronic
944196268 2:197057013-197057035 ATTGGACTGAGAGTCCTAGCTGG - Intronic
945110961 2:206359107-206359129 ACACTACTGGAAATCCTAGCTGG + Intergenic
945191899 2:207197224-207197246 ATATTATTGAAAGAACTAGCTGG - Intergenic
945843730 2:214918178-214918200 GTAGTACTGGAAATTCTAGCTGG + Intergenic
946795729 2:223350276-223350298 ATAGTACTGGAAGTCCTAACTGG + Intergenic
947773318 2:232688017-232688039 ATAGTACTGTCAGTCCAAGTGGG - Intergenic
1169505267 20:6203560-6203582 ATAGTATTGGAAGTCCTGGCTGG - Intergenic
1169517106 20:6329371-6329393 GTAATACTGGAAGTCCTAGATGG - Intergenic
1170014068 20:11761121-11761143 ATAGTACTGGAAGTCCTGGCCGG - Intergenic
1170030501 20:11939131-11939153 AAAGTGCTGAAATTACTAGCAGG + Intergenic
1170375522 20:15696056-15696078 ATAGTACTGGAAGTCCTAGAGGG - Intronic
1170831559 20:19846732-19846754 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1171133977 20:22680046-22680068 ACAGTACTGAAAGACCAAGAGGG + Intergenic
1171777585 20:29383580-29383602 ATAATTCTGAAATTCCTATCTGG - Intergenic
1171818866 20:29814270-29814292 ATAATGCTGAAAGTCCTATCTGG - Intergenic
1171898948 20:30838935-30838957 ATAATGCTGAAAGTCCTATCTGG + Intergenic
1172396326 20:34608498-34608520 ATAGTCCTCAAAGTCTTAACAGG - Intronic
1172720144 20:36993915-36993937 ATAGAAATGAAAATCCTGGCTGG + Intergenic
1173768782 20:45639577-45639599 ATAGTACTGAAAGTGCTAGCTGG - Intergenic
1176658297 21:9609133-9609155 ATAGTACTGAAAGTCTTAGCCGG - Intergenic
1177211814 21:18081352-18081374 ATAGTACTGTAAGTTCTCACTGG - Intronic
1177540139 21:22481860-22481882 ATAGCAGTGAAAGTGCTAGATGG - Intergenic
1177732838 21:25050991-25051013 ATAGTACAGGAAGTCCTGGTTGG + Intergenic
1177771736 21:25524151-25524173 ATAGTACTGGAAGTCCTAGCTGG + Intergenic
1177807984 21:25893875-25893897 CTAGTGATGAAAGTCCTAGATGG - Intronic
1178245748 21:30949859-30949881 ATTGTACTGGAAGTTCTAGTAGG + Intergenic
1178720189 21:35001625-35001647 ACAGTACTGGAAATTCTAGCCGG + Intronic
1179179486 21:39033355-39033377 ATTGTACTGAAAGCCTTTGCAGG + Intergenic
1179636260 21:42712080-42712102 ATAGTAATCAAAGTCATAGATGG - Intronic
1179814118 21:43892737-43892759 CTAGTTGTGAAAGTCCTAGATGG + Intronic
1180322842 22:11338959-11338981 ATAATGCTGAAAGTCCTATCTGG - Intergenic
1182332399 22:29560623-29560645 ATAGAACTTAATGTTCTAGCAGG - Intronic
1182400418 22:30071940-30071962 ATTGTACTGGAGGTTCTAGCCGG + Intergenic
949196100 3:1310132-1310154 ATTGTATTGGAAATCCTAGCTGG - Intronic
950266876 3:11580211-11580233 AGAGTAGTGAAAGTCCTAGAAGG - Intronic
950534326 3:13570546-13570568 ATAGTACTGGTAGCCCTCGCAGG - Exonic
951326555 3:21308969-21308991 ATATTACTAGAAGTCCTGGCCGG + Intergenic
952605579 3:35143516-35143538 ATAGTATTGGAGGTCCTGGCTGG + Intergenic
953287035 3:41620743-41620765 ATAGTATTGGAAGTTCTGGCTGG + Intronic
953306385 3:41833872-41833894 ATAGTATTGGAAGTTCTCGCCGG - Intronic
953468187 3:43143112-43143134 ATATTATTGAAAGACCTAGGAGG + Intergenic
953893649 3:46776489-46776511 ATAGTACTGGAAGTCTTAGCTGG + Intronic
954061919 3:48075226-48075248 ATAGAATTGAAAGTCCAGGCCGG + Intronic
954501115 3:51015144-51015166 ATAGTACTGGAAGTCCTAGCTGG - Intronic
955460411 3:59176191-59176213 ATAGCAGTGGAAGTCCTGGCTGG - Intergenic
956355166 3:68383199-68383221 ATAGTGTTGGAAGTCCTGGCTGG - Intronic
956661697 3:71604718-71604740 ATTATACTGGAAGTCCTAGAAGG + Intergenic
957087621 3:75697157-75697179 ATAATTCTGAAAGTCCTATCTGG + Intergenic
957304938 3:78445174-78445196 ATAATCCTGGAAGTCCTAACGGG + Intergenic
957433500 3:80144879-80144901 ATACTGCTGAGAGTCCTAGCTGG - Intergenic
957852870 3:85832818-85832840 ACTTTACTGAAATTCCTAGCCGG - Intronic
957916171 3:86690957-86690979 ATACTACTGGAAGTTCTAGCTGG + Intergenic
957966484 3:87328020-87328042 ATAGTACTGGAAGTCATAGCTGG + Intergenic
958100816 3:89007220-89007242 ATAGCACTGTAAGTCCTAGCTGG - Intergenic
958257075 3:91337427-91337449 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
958461584 3:94404688-94404710 ATACTACTAGAAGTCTTAGCCGG - Intergenic
958588686 3:96124796-96124818 ATAGTATTGGATCTCCTAGCTGG + Intergenic
958817879 3:98936773-98936795 ATAGCACTGAAAGTCCTAGCAGG + Intergenic
959046414 3:101479178-101479200 ATAGTAATGGAAGTCCTAGCCGG + Intronic
959355811 3:105326795-105326817 TTAGCCCTGAAAGTCCTAGATGG - Intergenic
959435831 3:106314236-106314258 ATAGTACTGTAAGTTCTAGCTGG - Intergenic
959458876 3:106599410-106599432 ATAGTACTGAAAGCCCTAGCCGG - Intergenic
959654499 3:108786260-108786282 ATAGTTCTGAAAGTACTAGCAGG - Intergenic
959825250 3:110786833-110786855 ATAGTTCTGGAAGTCTTAGCCGG - Intergenic
960020962 3:112952932-112952954 ATAATGCTGGAAGTTCTAGCTGG - Intronic
960479071 3:118166420-118166442 ATTGTAATGAAAGTTCTAGTTGG - Intergenic
962037982 3:131673826-131673848 ATGGAAATGGAAGTCCTAGCTGG - Intronic
962211197 3:133480068-133480090 ATACAACTGAAATTCCTGGCAGG + Intergenic
962692314 3:137911409-137911431 ATAGTATTGGAAGTTCTATCAGG + Intergenic
962926967 3:140003543-140003565 ATAGTACTGGAAGTCCTAGCTGG - Intronic
962999310 3:140662828-140662850 ACAGCACTAAAAGTCTTAGCTGG + Intergenic
963020260 3:140866763-140866785 ATTGCACTGGACGTCCTAGCTGG - Intergenic
963104650 3:141636568-141636590 ATTGTACTAGAGGTCCTAGCTGG + Intergenic
963570854 3:146993482-146993504 ATAGTACTGGAAGTCCTTGATGG - Intergenic
964462855 3:156955359-156955381 ATAGTATTGAAAGTTCTGGCCGG - Intronic
964554896 3:157926201-157926223 ATAGTATTGGAAGTCCTGGCTGG - Intergenic
964611114 3:158616302-158616324 ATAGTACTGGATGTCCCAGGTGG - Intergenic
964777030 3:160290111-160290133 CTACTACTGAAAGTCCTAATGGG + Intronic
964866001 3:161261951-161261973 ATAGCACTGGAAGTCCTAGCTGG - Intergenic
964929884 3:162004507-162004529 ATAATACTGGAAGTCCTAACTGG - Intergenic
964984334 3:162720576-162720598 ATAATGCTGTAAATCCTAGCAGG + Intergenic
965010426 3:163081029-163081051 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
965102219 3:164312199-164312221 ATAGTACTGGAAGTCATAACTGG + Intergenic
965728120 3:171741710-171741732 ATAGAACTGAAAATCTTTGCAGG + Intronic
965850010 3:173011584-173011606 ATCGTACTGCAAGTCCTAGCCGG + Intronic
965947096 3:174256109-174256131 ATAGTAATAGAAGTCCTATCAGG + Intronic
965952019 3:174320539-174320561 ATAGTACTGGAAGTCCAAGCCGG + Intergenic
966098164 3:176231161-176231183 CTAGTTATGAAAGTCCTAGATGG + Intergenic
966106589 3:176342989-176343011 ATAGTACTGGAAGTCCTAACAGG - Intergenic
966316370 3:178651037-178651059 ATAGTATTGGAAGTTCTGGCAGG + Intronic
966337543 3:178886130-178886152 ATAGTATTGGAAGTCCTGGCGGG + Intergenic
966342098 3:178936800-178936822 ATGGTACTGAAAGTCTTAGCTGG - Intergenic
966839175 3:184074786-184074808 CTAGCAGTGAAAGTCCTAGATGG - Intergenic
967661421 3:192115066-192115088 CTAGTTATGAAAGTCCTAGATGG + Intergenic
969404627 4:6981995-6982017 ATTGTATCGGAAGTCCTAGCTGG + Intronic
969837551 4:9855087-9855109 ATAGTACTGGAAGTCCCAACTGG + Intronic
971666474 4:29493335-29493357 AAAGTATTGGAAGTCCTAGCTGG - Intergenic
971797569 4:31248336-31248358 ATAATGCTGAAAGTCTTGGCTGG + Intergenic
972124423 4:35745274-35745296 ATAGTATTGGAAATCCTGGCTGG + Intergenic
972368752 4:38400878-38400900 ATAGCACTGTAAGTCTTAGCCGG - Intergenic
973762306 4:54129513-54129535 AAAGTACTGGAAGTCCTAAATGG - Intronic
974082413 4:57226331-57226353 ATACTACTGGAAGTTCTGGCTGG - Intergenic
974339715 4:60599884-60599906 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
974892955 4:67903750-67903772 ATATTACTGGAAGTCCTGGCTGG - Intergenic
975035555 4:69675547-69675569 ATAGTACTTGAAGTCCCAGCTGG + Intergenic
975124856 4:70770301-70770323 ATAGCTATGAAAGTCCTAGATGG + Intronic
975375669 4:73641843-73641865 ATAGTACTGCAAGTCCCAGATGG - Intergenic
975734982 4:77372371-77372393 ATAGTACTGGAGATCCTACCAGG + Intronic
975880040 4:78894284-78894306 ATAGCTCTAAAAGTCCTAGATGG + Intronic
976021619 4:80635776-80635798 TAAGTACTGAAAGTGGTAGCTGG + Intronic
976393717 4:84533153-84533175 ATAGCATTGGAAGTCCTAGCTGG + Intergenic
976728112 4:88235312-88235334 GAAGTACTGGAAGTCCTAGCTGG - Intergenic
977040635 4:92013012-92013034 GTGGTACTCGAAGTCCTAGCCGG + Intergenic
977072496 4:92408983-92409005 ATAGCACTGGAAGTCCTAGCAGG - Intronic
977158420 4:93603616-93603638 CTAGCTCTGAAAGTCCTAGATGG - Intronic
977915791 4:102591236-102591258 CTAGTTATGAAAGTCCTAGATGG - Intronic
977986018 4:103384523-103384545 ATAGTACTGAAAGTTCCAGCTGG + Intergenic
978112784 4:104983061-104983083 ATACTACTAGAAGTCCTCGCTGG + Intergenic
978163169 4:105574224-105574246 ATAGTACTGAAAATTCTAGCTGG - Intronic
978212906 4:106159268-106159290 ATAGTACTGGAAGTCCTAGCTGG + Intronic
978304091 4:107303157-107303179 CTAGCAATGAAAGTCCTAACTGG + Intergenic
978307111 4:107341864-107341886 ATAATATTGGAAGTCCTGGCAGG + Intergenic
978568617 4:110112127-110112149 AGGGTACTGAAAGTCTGAGCTGG + Intronic
978663875 4:111159527-111159549 ATAGTACTGGAAGTTCTAGTCGG + Intergenic
979184827 4:117774804-117774826 ATAGTACTGGAAGTCCTAGCTGG + Intergenic
979219289 4:118202826-118202848 ACAGTACTGGAAGTCATAGCTGG - Intronic
979892441 4:126115870-126115892 ATAGTACTGGAAATCTTAGCTGG - Intergenic
979921082 4:126497367-126497389 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
980428159 4:132654321-132654343 ATAGCACTAGAAATCCTAGCCGG - Intergenic
980499867 4:133635356-133635378 ATAGTACTGGATATCCTAACTGG + Intergenic
980654907 4:135768878-135768900 CTAGTTATGAAAGTCCTAGATGG + Intergenic
980749248 4:137067648-137067670 ATAGTACTGGAAATCCTAGCTGG - Intergenic
980865207 4:138546315-138546337 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
981187391 4:141819810-141819832 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
981223685 4:142266690-142266712 GTTATACTGAAAGTTCTAGCTGG + Intronic
981798318 4:148625293-148625315 CCAGTACTGGAAGTCCTAGCTGG + Intergenic
981825182 4:148932259-148932281 ATAGTACCGGAAGTCCTAGCTGG + Intergenic
982879312 4:160691086-160691108 ATAGTACTGGAAATTCTAGCCGG + Intergenic
983142326 4:164166625-164166647 ATAGTACTGGAAGTACTAGCAGG + Intronic
983469498 4:168139111-168139133 ATAGTACTAGGAGCCCTAGCTGG - Intronic
983588322 4:169380169-169380191 ATAATACTGGAAGTCCAAGCAGG + Intergenic
984104127 4:175522922-175522944 ATAGTACTGGAAGTCCTAGCAGG + Intergenic
984343899 4:178495283-178495305 ATAGTACTGGAAGCCCTAGCTGG + Intergenic
984454066 4:179942854-179942876 GTAGTTATGAAAGTCCTAGATGG + Intergenic
985332353 4:188852027-188852049 ATAGTACTGAAAATCCTAGTTGG - Intergenic
985443356 4:190001648-190001670 ATAATTCTGAAAGTCCTATCTGG - Intergenic
985847488 5:2362073-2362095 TTAGTGCTGGAAGTGCTAGCTGG - Intergenic
986358923 5:6956248-6956270 ATAGTATTGGAAGTTCTAGTCGG + Intergenic
986879272 5:12150197-12150219 ATGGTACTGGAAGTCCTAGTGGG - Intergenic
987773318 5:22334105-22334127 ATAGTACTGGAAGTCTTAGCTGG + Intronic
987986080 5:25147624-25147646 ATAGTACTGGAAGCTCTGGCCGG + Intergenic
988336727 5:29917679-29917701 ATAGTACTGGAAGTCCTGAACGG + Intergenic
989006816 5:36824029-36824051 ACAGTACTGGGAATCCTAGCCGG - Intergenic
989347830 5:40449943-40449965 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
989417099 5:41191919-41191941 ATAGTCCTGTAAGTCCTTGCTGG - Intronic
989727809 5:44607967-44607989 ATAGTACTGGAAGTCCTAGCCGG + Intergenic
989827556 5:45876279-45876301 ATAGTACTGAAAGTTCTGGCTGG - Intergenic
990222618 5:53609633-53609655 CTAGCTATGAAAGTCCTAGCTGG + Intronic
990577934 5:57141360-57141382 ATAGTACTGGAAGTGTCAGCTGG - Intergenic
990602446 5:57373271-57373293 ATAGCACTGGAAGTCCTGGCCGG + Intergenic
990891415 5:60654640-60654662 ATAGTACTGGAAGTCCTAGTTGG - Intronic
991107111 5:62856634-62856656 ATAGTACTGGTAGTCCTAGCTGG - Intergenic
992337852 5:75791736-75791758 ATACTATTGGAAGTCCTGGCTGG - Intergenic
993336112 5:86661048-86661070 ATAGTACTGGAAGTTCTGGCCGG - Intergenic
993607042 5:90004216-90004238 ATGGTACTGGAAGTCCTTCCTGG + Intergenic
993607746 5:90014664-90014686 ATAGTGCTGCTAGTCCCAGCTGG - Intergenic
994029113 5:95120812-95120834 ACAGTACTAGAAGTCCTAGCTGG + Intronic
994457620 5:100032352-100032374 TTGGTACTGAAAGTTCTAGCTGG + Intergenic
994558327 5:101332765-101332787 ATAGTACTGGAAGTCCTAGACGG + Intergenic
995003929 5:107168121-107168143 ATATTACAGAAAGGCCTAGGAGG - Intergenic
995445900 5:112243526-112243548 ATAGCTATGAAAGTCCTAGATGG + Intronic
995626328 5:114080808-114080830 ATAGTATTTAAAGTTCTAGGTGG + Intergenic
995704020 5:114966659-114966681 ATAGTACTGGAAGTACCAGCAGG + Intergenic
996451899 5:123635403-123635425 ATAGTACTGGAAATCCTAGCCGG + Intergenic
997115894 5:131125276-131125298 ATAGCATTGGAAGTCCTGGCTGG + Intergenic
997182858 5:131849799-131849821 ATACTACTGATAGTTCTAGCCGG + Intronic
997703412 5:135923452-135923474 TTAGTTATGAAAGTCCTAGATGG + Intronic
999028660 5:148264609-148264631 GTAGTACTGGAAGTCCTAACTGG + Intergenic
999863591 5:155677118-155677140 ACAGTACTGAAAGTTCCACCTGG - Intergenic
1000661222 5:163941052-163941074 CTAGCTCTGAAAGTCCTAGATGG - Intergenic
1000675944 5:164122633-164122655 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
1001973488 5:175977245-175977267 ATAGTACTGGAAGTCCTAACTGG + Intronic
1002243945 5:177866536-177866558 ATAGTACTGGAAGTCCTAACTGG - Intergenic
1002369132 5:178736557-178736579 ATAGTATTGAAAATCCTAGCCGG - Intergenic
1002550573 5:179987496-179987518 ATAGTGCTGGAAGTCATAGCCGG - Intronic
1002582733 5:180219593-180219615 GTAGTATTGGAAGTCCTAGCCGG - Intergenic
1002651123 5:180695449-180695471 ATACTACTGGGAGTCCCAGCTGG + Intergenic
1002678721 5:180941922-180941944 AAAGTACTGGAAGTCCTAGCCGG + Intronic
1003161683 6:3640768-3640790 ATAGTACTAGGAGTCCTAGCTGG + Intergenic
1003658435 6:8037111-8037133 ATAATACTGAAAGTACTGCCAGG + Intronic
1004440468 6:15645915-15645937 ATAATACTGGAAGTCCTAGCTGG + Intronic
1005365584 6:25073354-25073376 CTAGCTATGAAAGTCCTAGCTGG + Intergenic
1005909866 6:30299619-30299641 ATAGTACTGGAAGTTCTATTTGG - Intergenic
1006757366 6:36428148-36428170 AAAGTACTAAAATTCCTGGCCGG + Intronic
1007190304 6:40010268-40010290 ATAGTACTAGAAGGCCTAGCTGG - Intergenic
1007779151 6:44242172-44242194 ATTGTTCTGCAGGTCCTAGCTGG + Intergenic
1008467862 6:51850909-51850931 ATAGTATTGGAAGTTCTGGCCGG - Intronic
1008532138 6:52472330-52472352 ATTGTTCTGGAAGTCCTAGCTGG + Intronic
1008640724 6:53459766-53459788 ATAGTACTGGAAGTCCTAGCTGG + Intergenic
1008732793 6:54502987-54503009 ATAGAACTATAAGTCTTAGCTGG + Intergenic
1008973234 6:57394675-57394697 ATAGTACTGGAAGTCCTAGCCGG - Intronic
1008998225 6:57683615-57683637 ATAGTACTGGAAGTTCTGGCCGG + Intergenic
1009186726 6:60582979-60583001 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
1009371601 6:62910496-62910518 ATAGTACTGGAAGTCCTAGCTGG + Intergenic
1009467746 6:63993283-63993305 ATAGTACTGGAAGTCCTGGCTGG + Intronic
1009849369 6:69176150-69176172 ATAGTGCTGGAAGTACTTGCTGG - Intronic
1010288887 6:74112704-74112726 ATAGCTATGAAAGTCCTAGATGG - Intergenic
1010363299 6:75020013-75020035 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1010481903 6:76365463-76365485 ATCGTACTGGAAGTCCCAGCTGG - Intergenic
1010545920 6:77156037-77156059 GTAATCCTGGAAGTCCTAGCTGG - Intergenic
1010945286 6:81966889-81966911 ATGGTACTGAAAGACCTATGAGG + Intergenic
1011287720 6:85743125-85743147 ATAGTACTGGAAGTCTTAGCCGG - Intergenic
1011567600 6:88694078-88694100 ACAGTACTGGAAGTCCTTGCTGG + Intronic
1011867073 6:91842774-91842796 ATAGTATTGGAAGTCCTATCTGG - Intergenic
1011901748 6:92307084-92307106 ACAGTACTATAGGTCCTAGCTGG + Intergenic
1012304578 6:97637180-97637202 ATAGTTGTGAAAGTCCTAGATGG - Intergenic
1012509353 6:99984805-99984827 ATAGAACTGAAAGTCCTAGCTGG + Intronic
1012619840 6:101329797-101329819 ATTGTACTGAAAGTTCTAGTTGG - Intergenic
1012806809 6:103904953-103904975 ATAGTACTGGTAGACTTAGCTGG - Intergenic
1012913518 6:105143422-105143444 ACAGTACTGAAAGTCTTCGCTGG - Intergenic
1013381489 6:109576697-109576719 ATTGTACTGGAAGTCCTAGCTGG - Intronic
1013687693 6:112603981-112604003 ATAGTACTAAAAGTCATATTAGG + Intergenic
1014393193 6:120891026-120891048 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1014567085 6:122962474-122962496 ATAATACTGGAAGTCCTAACTGG + Intergenic
1014643893 6:123949812-123949834 ACAGTACTGAAAGTTCTGGCTGG - Intronic
1016088793 6:139949694-139949716 ATAGTGCTGGATGTCCTAGCTGG + Intergenic
1016405905 6:143730632-143730654 ATTGTAGTACAAGTCCTAGCTGG - Intronic
1016590810 6:145741554-145741576 ATAGTACTGGAAGTTCTGGCAGG - Intergenic
1016903321 6:149123845-149123867 TTAGAAATGAAAGTCCTAGAAGG - Intergenic
1017214562 6:151895406-151895428 ACAGTACCAGAAGTCCTAGCCGG - Intronic
1018052160 6:160019938-160019960 ATAGTACTGGAAGTCCTACCTGG + Intronic
1018917245 6:168142101-168142123 ATAGTACTGTAAGTCCTAGCTGG - Intergenic
1020422904 7:8029541-8029563 ATAGTACTGGAAGTCTTAGCTGG + Intronic
1020425865 7:8065418-8065440 ATAGTACTGGAAGTCCTGGCTGG - Intronic
1021023880 7:15640532-15640554 ATAGTACTGAAAGTCCTAGCAGG - Intronic
1021171624 7:17404555-17404577 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
1021465828 7:20942458-20942480 ACAGTGCTGGAAGTTCTAGCCGG + Intergenic
1021818249 7:24469902-24469924 ATAGTGCTGGATGTCCTAACTGG - Intergenic
1022788448 7:33662730-33662752 ATATTCCTGAAATTCTTAGCAGG - Intergenic
1022951427 7:35342107-35342129 CTAGCTATGAAAGTCCTAGCTGG - Intergenic
1023596491 7:41834434-41834456 ATAGAAGTGAAAGACCCAGCTGG - Intergenic
1023896874 7:44441386-44441408 TTGGTACTGAAAGTCCTCCCAGG - Intronic
1024726155 7:52198091-52198113 ACAGTACTGGAATTCCTAGCTGG - Intergenic
1024892157 7:54216410-54216432 CTAGTACTGAAAGTCCTAGCAGG + Intergenic
1026092586 7:67313633-67313655 ATAGCTGTGAAAGTCCTAGGTGG + Intergenic
1026581256 7:71619803-71619825 ATAGTACTGGAAGTCCTAGCTGG - Intronic
1027147803 7:75709694-75709716 ATAGTACTGGAAGTCCTAAACGG - Intronic
1027379219 7:77587693-77587715 CTAGTTCTGAAAATCCTAGATGG + Intronic
1027402017 7:77819248-77819270 ATACTACTGAAAGTCCTAGTTGG - Intronic
1027451846 7:78340934-78340956 ATAGTATTGGAAGTTCTGGCTGG + Intronic
1028033251 7:85945759-85945781 ATAGCACTGGAAGTCCTAGATGG - Intergenic
1028366997 7:90043927-90043949 ACAGCACTGGAAGTCCTAACTGG - Intergenic
1030136820 7:106260141-106260163 CTAGTTATGAAAGTCCTAGACGG + Intronic
1030421642 7:109313684-109313706 ATAGTACTGGAAGCCCTACATGG + Intergenic
1030691117 7:112535097-112535119 ATTGTACTGTAAGTTCTAGCTGG - Intergenic
1030781152 7:113601777-113601799 ATAGTATTGAAAGTTCCGGCCGG + Intergenic
1030936321 7:115588952-115588974 ATAGTAATGGAAGTCCTAGCCGG + Intergenic
1031005217 7:116462222-116462244 ATAGTACTGAAAGTACCATAAGG + Intronic
1031698341 7:124889546-124889568 ATAGTTGTGAAGGTCCTAGATGG - Intronic
1031924435 7:127625502-127625524 ATCATACTGGAAGTCCCAGCTGG - Intergenic
1032788754 7:135225211-135225233 ATTGTGCTGTAAGTTCTAGCTGG + Intergenic
1032814608 7:135459824-135459846 CTAGTAATCAAAGTCCTAGAAGG + Intronic
1033080509 7:138292514-138292536 CTAGCTATGAAAGTCCTAGCTGG + Intergenic
1033539935 7:142347197-142347219 CTGGTACTGAAAGTCACAGCTGG - Intergenic
1033833360 7:145279788-145279810 ATAGTACTGAAAGTCCTAGCTGG - Intergenic
1034096446 7:148412705-148412727 TTTGTACTGAAAATCCTACCCGG - Intronic
1034390512 7:150783845-150783867 GTAGTACTGGAAGTTCTAGCCGG + Intergenic
1034756453 7:153625809-153625831 ATAGTACTGAAAGTCCTAGCTGG - Intergenic
1036057548 8:5274576-5274598 ATAGTGCTGGAAGTTTTAGCCGG - Intergenic
1037136022 8:15461547-15461569 ATAGTACTGGAAGTCCTAGCCGG - Intronic
1038860625 8:31385240-31385262 GTAGTACTGGAAGTCCTAGCTGG + Intergenic
1039293044 8:36119711-36119733 ATAATGTTGGAAGTCCTAGCCGG + Intergenic
1041770007 8:61462936-61462958 CTAGTTATGAAAGTCCTAGATGG + Intronic
1041972236 8:63757069-63757091 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1042032814 8:64495159-64495181 ATAGTACTGGAAGTCCTACCTGG + Intergenic
1042163066 8:65917584-65917606 ATAGTACTGGAGGTCCTGGCTGG + Intergenic
1042202649 8:66294855-66294877 ATAGTGTTGGAAGTTCTAGCTGG - Intergenic
1042298384 8:67247691-67247713 AAAGTACTGAAAGAACTAGCTGG + Intronic
1042897170 8:73683587-73683609 ACAGTACTGGAAGTCCTAGCCGG + Intronic
1043386048 8:79748850-79748872 GTAGTACCGGAATTCCTAGCAGG - Intergenic
1043627326 8:82278034-82278056 ATAGTACTGAAAGTCCTAGCTGG + Intergenic
1043666133 8:82816727-82816749 ATAGTACTGGACGTCCTAGCCGG - Intergenic
1043674358 8:82931514-82931536 ATAGTACCGAAAGTTCTAGCTGG + Intergenic
1044130050 8:88510398-88510420 ACAGTAGTGAAAGTTCTAGCTGG + Intergenic
1044222224 8:89682487-89682509 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
1044640009 8:94369423-94369445 CTAGCTATGAAAGTCCTAGCTGG - Intergenic
1045164270 8:99585806-99585828 ATTGTACTGGAAGTTCTAGTTGG + Intronic
1046711211 8:117513692-117513714 ATAGTACTGGAAATTCTGGCAGG + Intergenic
1047663980 8:127069624-127069646 ATAGGTATGAAAGTCCTAGATGG - Intergenic
1047910480 8:129523186-129523208 ATAGTATGGGAAGTCCTAGCTGG + Intergenic
1048920093 8:139220766-139220788 ATCGTACTGGAAGTCCTTGCTGG + Intergenic
1049620215 8:143594754-143594776 AAGGTACTGAAAGTTCTATCAGG - Intronic
1050233993 9:3558874-3558896 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1050401128 9:5256265-5256287 ATAGTAGTGGAAGTCCTAGCCGG - Intergenic
1050852441 9:10304390-10304412 ATAGTATTGGAAGTTCTGGCCGG + Intronic
1051601035 9:18874311-18874333 ATAGTACTGGAAGCCCTAGCCGG - Intronic
1051806479 9:20998468-20998490 ATAGTTCTGAGAGACCTATCAGG - Intergenic
1051833046 9:21302263-21302285 ATAGTACTGGAAGTCCTGGCTGG + Intergenic
1052011660 9:23417848-23417870 CTAGTCCTGAAAGTCCTTGTGGG + Intergenic
1052253888 9:26430825-26430847 ATAGTACTGGAAGTCCTCCCCGG + Intergenic
1052751641 9:32497869-32497891 TTAGTATTGGAAGTCCTAGCTGG - Intronic
1053421325 9:37981153-37981175 ATGGCTCTGAAAGTCCTAGATGG + Intronic
1054895900 9:70310675-70310697 CTAGTTATGAAAGTCCTAGATGG + Intronic
1055534956 9:77231241-77231263 ATACTACTGGAGGTTCTAGCCGG - Intronic
1055820879 9:80261995-80262017 ATAGTACTGGAAGTACAAGCAGG + Intergenic
1055895203 9:81166560-81166582 ATAGTATTGGAAGTTCTGGCCGG + Intergenic
1056010380 9:82323187-82323209 ATAGTACTGGAAGTTCTGGCCGG - Intergenic
1056184011 9:84114263-84114285 ATAGTACTGGAGGTCTTAGCTGG - Intergenic
1056996228 9:91462224-91462246 ATTGTATTGACAGTCATAGCAGG - Intergenic
1057571685 9:96208569-96208591 ATTGTCCTGGAGGTCCTAGCTGG - Intergenic
1058403237 9:104641331-104641353 ATAGTACTGGAAGTCCTGGCCGG + Intergenic
1059144035 9:111881635-111881657 ATTATACTGGAAGTTCTAGCTGG + Intergenic
1059547291 9:115190317-115190339 ATAGTACTAGAAGTCCCATCTGG + Intronic
1059884003 9:118724588-118724610 ATAGTACTGGAAGTGCTAGCCGG - Intergenic
1060336910 9:122733257-122733279 ATAGTATTGCAAGTCCTAGCCGG + Intergenic
1060685248 9:125604705-125604727 ATAGTATTGAAAGTGCAAGAGGG + Intronic
1061229190 9:129303353-129303375 ATTGTGCTGAAAGTCCTAACTGG + Intergenic
1062739858 9:138165319-138165341 ATAATTCTGAAAGTCCTATCTGG + Intergenic
1203370531 Un_KI270442v1:299538-299560 ATAATGCTGAAAGTCTTATCTGG - Intergenic
1203636027 Un_KI270750v1:112708-112730 ATAGTACTGAAAGTCTTAGCTGG - Intergenic
1186138405 X:6544947-6544969 ACAGTATTGAAAGTTCTGGCTGG - Intergenic
1186601770 X:11045834-11045856 ATAGTACTGGAAGTTCTCGCTGG - Intergenic
1188020354 X:25150534-25150556 ATAGTACTGGAAGTCCTAGCTGG - Intergenic
1188658041 X:32722939-32722961 ATAGTACCAAAAATACTAGCAGG - Intronic
1188902885 X:35756586-35756608 ATAGTACTGGAAGTCCTAACAGG + Intergenic
1188971816 X:36627051-36627073 ATAGTACTGGAAGTCCCAGCTGG - Intergenic
1189572206 X:42310132-42310154 ATAGTACTGGAAGTTCTGGCCGG + Intergenic
1189672869 X:43430115-43430137 GTAGTACTGGAAGTTCTGGCAGG - Intergenic
1189690104 X:43608089-43608111 ATGGTACTGGAAGTCCTAGCTGG - Intergenic
1190141875 X:47853956-47853978 CTAGCTATGAAAGTCCTAGCTGG + Intronic
1190589250 X:51981439-51981461 ATTGTACTGAAAGTTCTAACTGG - Intergenic
1191041178 X:56081492-56081514 AGTGTACTGAAAGTTTTAGCTGG - Intergenic
1191134341 X:57047569-57047591 ATAGTATAGGAAGTTCTAGCTGG + Intergenic
1191799361 X:65060225-65060247 ACAATACTGAAATTCCTAGCTGG - Intergenic
1191801286 X:65083239-65083261 ACATTACTGGAATTCCTAGCTGG + Intergenic
1191926895 X:66322559-66322581 ATAGGACTGGAAGTCCTACATGG + Intergenic
1191927420 X:66328828-66328850 ATAGTATTGGAAGTTTTAGCTGG - Intergenic
1192070309 X:67932511-67932533 ATAGCACTGGAAGTCCTAGCTGG + Intergenic
1192548526 X:72033902-72033924 ATAATACTGGAAGCTCTAGCTGG - Intergenic
1192633673 X:72797110-72797132 TTAGTATTGAAAGTTCTAGCCGG - Intronic
1192648037 X:72923691-72923713 TTAGTATTGAAAGTTCTAGCCGG + Intronic
1192661954 X:73050898-73050920 ATAGTCCTGGAAGTCCTAGATGG + Intergenic
1192781823 X:74302057-74302079 ATTGTGCTGGAAGTTCTAGCTGG + Intergenic
1192891397 X:75395183-75395205 ACAGTACTAGAAGTCCTAGCTGG + Intronic
1192912080 X:75615771-75615793 ATAATACTGGAAGTTCTGGCCGG + Intergenic
1192958520 X:76101002-76101024 ATAGCTCTGAAAGTCCTACCTGG - Intergenic
1193192524 X:78588600-78588622 ATAGTACTGGAAGTTCTAGCTGG - Intergenic
1193200080 X:78678927-78678949 ATAGTATTGGAAGTTCTGGCTGG - Intergenic
1193270744 X:79528061-79528083 ATAGTACTGGAAGTCCTAGCTGG + Intergenic
1193291085 X:79773540-79773562 ATAGTACTGGAAGTGTTAGCTGG - Intergenic
1193327909 X:80203763-80203785 ATAGTACTGAAAGTCCTAGCCGG - Intergenic
1193396912 X:80995427-80995449 ATAGTTCTGGAAGTTCTAGCTGG + Intergenic
1193461893 X:81800358-81800380 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
1193643656 X:84041500-84041522 ATAGTACCAGAAGTCCTAGCTGG - Intergenic
1193683380 X:84549311-84549333 ATAATACTGAAAGTCCTAGCTGG - Intergenic
1194042552 X:88960631-88960653 ATTGTACTGGAAGTCCTAGCTGG - Intergenic
1194192383 X:90853854-90853876 ATAGTACTGGAAATTCTAGGTGG - Intergenic
1194265572 X:91749602-91749624 CTAGGACTGAATGTCCTAGAAGG + Intergenic
1194285280 X:92002903-92002925 ATAGCACTGGAAGTTCCAGCTGG - Intronic
1194372008 X:93085496-93085518 ATAGTACTGGGAGTCCTAGCTGG - Intergenic
1194733943 X:97489452-97489474 ATAGTACTGGAAGCTCTAGCTGG - Intronic
1194882246 X:99268362-99268384 ATAGTACTGGAAGGCCTAACCGG - Intergenic
1195151576 X:102076056-102076078 ATAGTTCTGAAAGTTCTATCCGG + Intergenic
1195558369 X:106253843-106253865 ATATTACTGGAAATCCTTGCTGG - Intergenic
1195735139 X:108004919-108004941 ATAATACTGAAATTACTAGCTGG + Intergenic
1196044568 X:111244294-111244316 ATAGTATTGGAAGTTCTGGCCGG - Intergenic
1196137147 X:112222419-112222441 ATAGTAAAGATATTCCTAGCTGG + Intergenic
1196244717 X:113387410-113387432 ATAGTACTGGAAGTCCTGACTGG - Intergenic
1196338991 X:114573587-114573609 ATAGTACTGGAAATCTTAGAGGG + Intergenic
1196368018 X:114944808-114944830 TTAGAGCTGAAAGTCCTAGAAGG - Intergenic
1196575423 X:117312438-117312460 ATAGTAGTGCAAGCCCTAGCCGG - Intergenic
1197077722 X:122373568-122373590 ATAGTTCTGTAAGTCCTACCTGG - Intergenic
1197094657 X:122578964-122578986 ACAGTACTGGAAGTCCTGGCTGG + Intergenic
1197302597 X:124799616-124799638 ATAGTATTGTAAGTTCTGGCAGG - Intronic
1197465596 X:126800808-126800830 ATAGTACTGGAAATCATAGCTGG + Intergenic
1197581563 X:128290095-128290117 ATAGCACTGGAAGTTCTAGCTGG + Intergenic
1197687424 X:129456016-129456038 CTAGTTATGAAAGTCCTAGATGG - Intronic
1197806009 X:130399211-130399233 AGAGTACTGAAAGAGCTAGGAGG + Intergenic
1197810665 X:130439851-130439873 ACAGTACTGGAAGTGCTAGCCGG - Intergenic
1197899190 X:131351103-131351125 ATAGTAATAAAAGTCCCAGCAGG + Intronic
1198234103 X:134719977-134719999 ATTATACTGGAAGTTCTAGCTGG + Intronic
1199035674 X:143047754-143047776 ATAGTACTGGAATGCCTAGCTGG - Intergenic
1199316346 X:146382730-146382752 ATAGTACTAGAAGTCCCAGAGGG + Intergenic
1199398798 X:147372584-147372606 ATAGTCCTGGAAGACCTAGCAGG - Intergenic
1199425823 X:147699627-147699649 ATAGTACTGCAAGTCCTAGCCGG + Intergenic
1199436983 X:147823526-147823548 ATAGTATTGGAAGTTCTGGCTGG + Intergenic
1199706745 X:150433422-150433444 ATAGTATTGGAAGTCCTATCAGG - Intronic
1200539020 Y:4436304-4436326 ATAGTACTGGAAATTCTAGGTGG - Intergenic
1200582722 Y:4970044-4970066 CTAGGACTGAATGTCCTAGAAGG + Intergenic
1200602848 Y:5227445-5227467 ATAGCACTGGAAGTTCCAGCTGG - Intronic
1200680053 Y:6199533-6199555 ATAGTACTGGGAGTCCTAGCTGG - Intergenic
1201067776 Y:10115538-10115560 ATAATGCTGAAAGTCCTATCTGG + Intergenic
1201760532 Y:17532217-17532239 ATAATTCTGAAAGTCCTATCTGG - Intergenic
1201841022 Y:18373773-18373795 ATAATTCTGAAAGTCCTATCTGG + Intergenic